FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629966_at:

>probe:Drosophila_2:1629966_at:281:613; Interrogation_Position=110; Antisense; TGAAAACACTTGTCGCCGAGCTACG
>probe:Drosophila_2:1629966_at:21:607; Interrogation_Position=138; Antisense; TGATGATGGCATCCTGCGCATGGAC
>probe:Drosophila_2:1629966_at:371:53; Interrogation_Position=172; Antisense; ATGCTCGAGTCAGCGGTGATCTTCA
>probe:Drosophila_2:1629966_at:678:533; Interrogation_Position=186; Antisense; GGTGATCTTCATGCGCCAGCAAAAG
>probe:Drosophila_2:1629966_at:592:571; Interrogation_Position=268; Antisense; GGCTACATGAATGCCGTCAACGAGG
>probe:Drosophila_2:1629966_at:178:199; Interrogation_Position=286; Antisense; AACGAGGTGTCACGTGTCATGGCCT
>probe:Drosophila_2:1629966_at:611:569; Interrogation_Position=319; Antisense; GGCATGAGCGTCGACCTGGGCAAAT
>probe:Drosophila_2:1629966_at:488:605; Interrogation_Position=347; Antisense; TGATGACTCACCTGGGACGCGTCTA
>probe:Drosophila_2:1629966_at:458:523; Interrogation_Position=360; Antisense; GGGACGCGTCTACAAGAACTTGCAG
>probe:Drosophila_2:1629966_at:421:385; Interrogation_Position=375; Antisense; GAACTTGCAGCAATTCCACGAAGCA
>probe:Drosophila_2:1629966_at:334:441; Interrogation_Position=429; Antisense; GATGGACTGCTCCTCAATGGACAAG
>probe:Drosophila_2:1629966_at:590:631; Interrogation_Position=475; Antisense; TCCGGATATCACAGCGACTGCGACA
>probe:Drosophila_2:1629966_at:479:375; Interrogation_Position=51; Antisense; GAAGAAGCCAATGCTGGAGCGCCAG
>probe:Drosophila_2:1629966_at:523:185; Interrogation_Position=91; Antisense; AACAAGTGCCTGGACAACCTGAAAA

Paste this into a BLAST search page for me
TGAAAACACTTGTCGCCGAGCTACGTGATGATGGCATCCTGCGCATGGACATGCTCGAGTCAGCGGTGATCTTCAGGTGATCTTCATGCGCCAGCAAAAGGGCTACATGAATGCCGTCAACGAGGAACGAGGTGTCACGTGTCATGGCCTGGCATGAGCGTCGACCTGGGCAAATTGATGACTCACCTGGGACGCGTCTAGGGACGCGTCTACAAGAACTTGCAGGAACTTGCAGCAATTCCACGAAGCAGATGGACTGCTCCTCAATGGACAAGTCCGGATATCACAGCGACTGCGACAGAAGAAGCCAATGCTGGAGCGCCAGAACAAGTGCCTGGACAACCTGAAAA

Full Affymetrix probeset data:

Annotations for 1629966_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720