FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629969_at:

>probe:Drosophila_2:1629969_at:98:127; Interrogation_Position=1318; Antisense; AGCCGGCACTTTGTGCAGTTCGCAG
>probe:Drosophila_2:1629969_at:74:267; Interrogation_Position=1333; Antisense; CAGTTCGCAGTGGTGATGGTAGCCT
>probe:Drosophila_2:1629969_at:124:65; Interrogation_Position=1348; Antisense; ATGGTAGCCTGGTATACGGCCCTCA
>probe:Drosophila_2:1629969_at:216:577; Interrogation_Position=1365; Antisense; GGCCCTCAGCCGTGTAATGGACCAT
>probe:Drosophila_2:1629969_at:265:493; Interrogation_Position=1378; Antisense; GTAATGGACCATTGGCACCACTGGT
>probe:Drosophila_2:1629969_at:651:667; Interrogation_Position=1424; Antisense; TACTTGGCGTGGCTGGCGCTCTAAT
>probe:Drosophila_2:1629969_at:719:209; Interrogation_Position=1488; Antisense; AAGCAATATTCTAAGCGGTGGCCTG
>probe:Drosophila_2:1629969_at:66:435; Interrogation_Position=1515; Antisense; GAGGGAAAACACAGCGGCCACTCTG
>probe:Drosophila_2:1629969_at:382:489; Interrogation_Position=1572; Antisense; GTACTCCGTGAACAACAGCTTCAGC
>probe:Drosophila_2:1629969_at:626:187; Interrogation_Position=1585; Antisense; AACAGCTTCAGCGAGGATCAGTACT
>probe:Drosophila_2:1629969_at:367:543; Interrogation_Position=1599; Antisense; GGATCAGTACTGCTCTAAGGTTTAG
>probe:Drosophila_2:1629969_at:129:447; Interrogation_Position=1636; Antisense; GATGCTTTCGTAGCGATGTCAATTC
>probe:Drosophila_2:1629969_at:550:571; Interrogation_Position=1765; Antisense; GGCTCATGTGAGTCTGTTCCTGCAA
>probe:Drosophila_2:1629969_at:549:285; Interrogation_Position=1778; Antisense; CTGTTCCTGCAATCTCATCTAAGTA

Paste this into a BLAST search page for me
AGCCGGCACTTTGTGCAGTTCGCAGCAGTTCGCAGTGGTGATGGTAGCCTATGGTAGCCTGGTATACGGCCCTCAGGCCCTCAGCCGTGTAATGGACCATGTAATGGACCATTGGCACCACTGGTTACTTGGCGTGGCTGGCGCTCTAATAAGCAATATTCTAAGCGGTGGCCTGGAGGGAAAACACAGCGGCCACTCTGGTACTCCGTGAACAACAGCTTCAGCAACAGCTTCAGCGAGGATCAGTACTGGATCAGTACTGCTCTAAGGTTTAGGATGCTTTCGTAGCGATGTCAATTCGGCTCATGTGAGTCTGTTCCTGCAACTGTTCCTGCAATCTCATCTAAGTA

Full Affymetrix probeset data:

Annotations for 1629969_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720