FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629972_at:

>probe:Drosophila_2:1629972_at:613:215; Interrogation_Position=1017; Antisense; AAGATCTTTCATCCGAATGTGGCCG
>probe:Drosophila_2:1629972_at:596:545; Interrogation_Position=1088; Antisense; GGATCTGGGCATCAAGCACATTCTG
>probe:Drosophila_2:1629972_at:513:33; Interrogation_Position=1119; Antisense; ATCAAATGCCTGCTTATTGTCCCGA
>probe:Drosophila_2:1629972_at:640:689; Interrogation_Position=1133; Antisense; TATTGTCCCGAATCCGGAATCGGCG
>probe:Drosophila_2:1629972_at:239:405; Interrogation_Position=1200; Antisense; GACTACTCACAGAGGGCGCGCATGA
>probe:Drosophila_2:1629972_at:208:607; Interrogation_Position=1222; Antisense; TGATGACAGAGATCCATGCCCAGCC
>probe:Drosophila_2:1629972_at:403:625; Interrogation_Position=1238; Antisense; TGCCCAGCCTGCCAAATGCGGTGTA
>probe:Drosophila_2:1629972_at:230:601; Interrogation_Position=1259; Antisense; TGTAGGCGCTGTTGGCGATGCCAAA
>probe:Drosophila_2:1629972_at:198:211; Interrogation_Position=1282; Antisense; AAGACGATGGTGGACCCTCGACGAA
>probe:Drosophila_2:1629972_at:626:135; Interrogation_Position=1302; Antisense; ACGAAGAAGCATGCGGGCCTGGACA
>probe:Drosophila_2:1629972_at:410:551; Interrogation_Position=836; Antisense; GGAGATGGAAACCACGCCACCGGAA
>probe:Drosophila_2:1629972_at:689:5; Interrogation_Position=908; Antisense; ATTGATCGATGGACCTGCTGGCACT
>probe:Drosophila_2:1629972_at:252:297; Interrogation_Position=941; Antisense; CGCTGGAATTTTCCGCGTCAAACTG
>probe:Drosophila_2:1629972_at:538:409; Interrogation_Position=965; Antisense; GACGCTGAACAAGGACTTCCCGCTG

Paste this into a BLAST search page for me
AAGATCTTTCATCCGAATGTGGCCGGGATCTGGGCATCAAGCACATTCTGATCAAATGCCTGCTTATTGTCCCGATATTGTCCCGAATCCGGAATCGGCGGACTACTCACAGAGGGCGCGCATGATGATGACAGAGATCCATGCCCAGCCTGCCCAGCCTGCCAAATGCGGTGTATGTAGGCGCTGTTGGCGATGCCAAAAAGACGATGGTGGACCCTCGACGAAACGAAGAAGCATGCGGGCCTGGACAGGAGATGGAAACCACGCCACCGGAAATTGATCGATGGACCTGCTGGCACTCGCTGGAATTTTCCGCGTCAAACTGGACGCTGAACAAGGACTTCCCGCTG

Full Affymetrix probeset data:

Annotations for 1629972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720