FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629973_at:

>probe:Drosophila_2:1629973_at:601:699; Interrogation_Position=1545; Antisense; TTTATCCTTTGACGAAATCCGCTGG
>probe:Drosophila_2:1629973_at:64:375; Interrogation_Position=1578; Antisense; GAAGTTTCCCTTTCAATCTTGCATC
>probe:Drosophila_2:1629973_at:176:37; Interrogation_Position=1593; Antisense; ATCTTGCATCAAACTCACCTACATA
>probe:Drosophila_2:1629973_at:402:193; Interrogation_Position=1604; Antisense; AACTCACCTACATATACTTTCTAAA
>probe:Drosophila_2:1629973_at:449:63; Interrogation_Position=1698; Antisense; ATGTGTCTCAATTGTTGGCTGTCGT
>probe:Drosophila_2:1629973_at:280:599; Interrogation_Position=1717; Antisense; TGTCGTGGCTTCTTTTCATGTATGT
>probe:Drosophila_2:1629973_at:535:679; Interrogation_Position=1737; Antisense; TATGTGGGCATACATGTGCGGCATC
>probe:Drosophila_2:1629973_at:418:507; Interrogation_Position=1752; Antisense; GTGCGGCATCTTCTTTGTAATACTT
>probe:Drosophila_2:1629973_at:377:717; Interrogation_Position=1808; Antisense; TTCGCAGTGCTGTCAATTCAATTCT
>probe:Drosophila_2:1629973_at:325:7; Interrogation_Position=1828; Antisense; ATTCTTTGGCTAATTTGATTCTCGA
>probe:Drosophila_2:1629973_at:69:727; Interrogation_Position=1842; Antisense; TTGATTCTCGAATCGGGAAGCAGAA
>probe:Drosophila_2:1629973_at:191:167; Interrogation_Position=1870; Antisense; AAATGTATCTGTTTGTAGCGAAGGA
>probe:Drosophila_2:1629973_at:684:485; Interrogation_Position=1959; Antisense; GTAGCTGAATCGAATGCCGTAGCAA
>probe:Drosophila_2:1629973_at:116:369; Interrogation_Position=2056; Antisense; GAATGCGACATACCAAAAGAGATTT

Paste this into a BLAST search page for me
TTTATCCTTTGACGAAATCCGCTGGGAAGTTTCCCTTTCAATCTTGCATCATCTTGCATCAAACTCACCTACATAAACTCACCTACATATACTTTCTAAAATGTGTCTCAATTGTTGGCTGTCGTTGTCGTGGCTTCTTTTCATGTATGTTATGTGGGCATACATGTGCGGCATCGTGCGGCATCTTCTTTGTAATACTTTTCGCAGTGCTGTCAATTCAATTCTATTCTTTGGCTAATTTGATTCTCGATTGATTCTCGAATCGGGAAGCAGAAAAATGTATCTGTTTGTAGCGAAGGAGTAGCTGAATCGAATGCCGTAGCAAGAATGCGACATACCAAAAGAGATTT

Full Affymetrix probeset data:

Annotations for 1629973_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720