Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629974_at:

>probe:Drosophila_2:1629974_at:283:615; Interrogation_Position=3396; Antisense; TGAATGCCCTGCAGGCAGATGAAGA
>probe:Drosophila_2:1629974_at:674:613; Interrogation_Position=3415; Antisense; TGAAGAAGCACGTGATACCCATCAG
>probe:Drosophila_2:1629974_at:516:511; Interrogation_Position=3426; Antisense; GTGATACCCATCAGGCTGCCAAGCG
>probe:Drosophila_2:1629974_at:369:337; Interrogation_Position=3440; Antisense; GCTGCCAAGCGCCTTAAGAACGAAA
>probe:Drosophila_2:1629974_at:364:61; Interrogation_Position=3464; Antisense; ATGTACGCCGAGGATGATAACTCAT
>probe:Drosophila_2:1629974_at:476:605; Interrogation_Position=3478; Antisense; TGATAACTCATCCACAATGCTCGAC
>probe:Drosophila_2:1629974_at:621:593; Interrogation_Position=3504; Antisense; TGGGCGACTCCACCAGATATGAGAG
>probe:Drosophila_2:1629974_at:345:187; Interrogation_Position=3612; Antisense; AACACAAGCATAGGCACAGCAAGGA
>probe:Drosophila_2:1629974_at:143:225; Interrogation_Position=3671; Antisense; AAGGACAAGCGTGACCCGCATATAT
>probe:Drosophila_2:1629974_at:118:23; Interrogation_Position=3690; Antisense; ATATATCACGCCTGCAGGCGCGCGA
>probe:Drosophila_2:1629974_at:208:399; Interrogation_Position=3728; Antisense; GACACTCTCAGCTCGGAGGACAGTA
>probe:Drosophila_2:1629974_at:349:311; Interrogation_Position=3769; Antisense; GCCGCCCATGAACCTTAACTAAGTG
>probe:Drosophila_2:1629974_at:136:193; Interrogation_Position=3785; Antisense; AACTAAGTGAGGGTTCTTGCAGGTG
>probe:Drosophila_2:1629974_at:720:563; Interrogation_Position=3945; Antisense; GGAAGTGTGCTGAAACATTTTTACA

Paste this into a BLAST search page for me
TGAATGCCCTGCAGGCAGATGAAGATGAAGAAGCACGTGATACCCATCAGGTGATACCCATCAGGCTGCCAAGCGGCTGCCAAGCGCCTTAAGAACGAAAATGTACGCCGAGGATGATAACTCATTGATAACTCATCCACAATGCTCGACTGGGCGACTCCACCAGATATGAGAGAACACAAGCATAGGCACAGCAAGGAAAGGACAAGCGTGACCCGCATATATATATATCACGCCTGCAGGCGCGCGAGACACTCTCAGCTCGGAGGACAGTAGCCGCCCATGAACCTTAACTAAGTGAACTAAGTGAGGGTTCTTGCAGGTGGGAAGTGTGCTGAAACATTTTTACA

Full Affymetrix probeset data:

Annotations for 1629974_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime