FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629975_at:

>probe:Drosophila_2:1629975_at:359:683; Interrogation_Position=289; Antisense; TATGCCCATGCTCCCGAGGAGGTGA
>probe:Drosophila_2:1629975_at:396:523; Interrogation_Position=339; Antisense; GGGCCACTCTCACGGACATGATTAT
>probe:Drosophila_2:1629975_at:600:141; Interrogation_Position=374; Antisense; ACGGCCACGGCTCGGATGTTAAGAT
>probe:Drosophila_2:1629975_at:521:269; Interrogation_Position=408; Antisense; CATCCAGGAGGAGGGTCACAGCCAT
>probe:Drosophila_2:1629975_at:242:141; Interrogation_Position=443; Antisense; ACGGTTACGACTACTCCAGCGGAGG
>probe:Drosophila_2:1629975_at:351:207; Interrogation_Position=508; Antisense; AAGCTGATCAGCTCCGGAATCGCCG
>probe:Drosophila_2:1629975_at:307:291; Interrogation_Position=579; Antisense; CGGTGGCTCCGGATGGAACTAAGCA
>probe:Drosophila_2:1629975_at:489:93; Interrogation_Position=603; Antisense; AGTTCCTCGGAGATGCTCGGACATT
>probe:Drosophila_2:1629975_at:25:559; Interrogation_Position=621; Antisense; GGACATTCCAACAGATGCCAGGCAA
>probe:Drosophila_2:1629975_at:278:73; Interrogation_Position=640; Antisense; AGGCAACCCAGTGCGCTGATGTCAA
>probe:Drosophila_2:1629975_at:627:193; Interrogation_Position=663; Antisense; AACTCTTTTGTTCCTGTTGTCGGAG
>probe:Drosophila_2:1629975_at:679:19; Interrogation_Position=698; Antisense; ATATTGGCCTTTTTCGATGCTCGAA
>probe:Drosophila_2:1629975_at:361:475; Interrogation_Position=723; Antisense; GTTAGTTTAGGACAGCGCACGCGTT
>probe:Drosophila_2:1629975_at:579:299; Interrogation_Position=742; Antisense; CGCGTTTTGTGTGTGCGCTTAGAAA

Paste this into a BLAST search page for me
TATGCCCATGCTCCCGAGGAGGTGAGGGCCACTCTCACGGACATGATTATACGGCCACGGCTCGGATGTTAAGATCATCCAGGAGGAGGGTCACAGCCATACGGTTACGACTACTCCAGCGGAGGAAGCTGATCAGCTCCGGAATCGCCGCGGTGGCTCCGGATGGAACTAAGCAAGTTCCTCGGAGATGCTCGGACATTGGACATTCCAACAGATGCCAGGCAAAGGCAACCCAGTGCGCTGATGTCAAAACTCTTTTGTTCCTGTTGTCGGAGATATTGGCCTTTTTCGATGCTCGAAGTTAGTTTAGGACAGCGCACGCGTTCGCGTTTTGTGTGTGCGCTTAGAAA

Full Affymetrix probeset data:

Annotations for 1629975_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720