FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629977_at:

>probe:Drosophila_2:1629977_at:448:183; Interrogation_Position=217; Antisense; AAAATTGAAGTCTCGCTTCCGGAGG
>probe:Drosophila_2:1629977_at:617:729; Interrogation_Position=252; Antisense; TTGGATACAATTGCGCCAGGACCTG
>probe:Drosophila_2:1629977_at:688:421; Interrogation_Position=331; Antisense; GAGAATCCGCTGGTTCCGTTGGGAT
>probe:Drosophila_2:1629977_at:343:631; Interrogation_Position=345; Antisense; TCCGTTGGGATGTTTGGCCACTACA
>probe:Drosophila_2:1629977_at:562:155; Interrogation_Position=367; Antisense; ACAGCGGCGCTCACAGCTGGCTTAT
>probe:Drosophila_2:1629977_at:73:333; Interrogation_Position=382; Antisense; GCTGGCTTATACAACTTTCGCACTG
>probe:Drosophila_2:1629977_at:499:191; Interrogation_Position=394; Antisense; AACTTTCGCACTGGCAATCGCAAGA
>probe:Drosophila_2:1629977_at:667:361; Interrogation_Position=407; Antisense; GCAATCGCAAGATGTCGCAGCTGAT
>probe:Drosophila_2:1629977_at:497:353; Interrogation_Position=423; Antisense; GCAGCTGATGATGCGAAGTCGTATC
>probe:Drosophila_2:1629977_at:384:499; Interrogation_Position=440; Antisense; GTCGTATCGCGGCTCAGGGATTTAC
>probe:Drosophila_2:1629977_at:433:395; Interrogation_Position=457; Antisense; GGATTTACCGTTATGGCCCTAGTTG
>probe:Drosophila_2:1629977_at:701:5; Interrogation_Position=469; Antisense; ATGGCCCTAGTTGTCGGCGTCGTCA
>probe:Drosophila_2:1629977_at:444:329; Interrogation_Position=485; Antisense; GCGTCGTCATGACCTACACTGATAA
>probe:Drosophila_2:1629977_at:567:207; Interrogation_Position=610; Antisense; AAGCTAATACTAAGGGCTGCAAATT

Paste this into a BLAST search page for me
AAAATTGAAGTCTCGCTTCCGGAGGTTGGATACAATTGCGCCAGGACCTGGAGAATCCGCTGGTTCCGTTGGGATTCCGTTGGGATGTTTGGCCACTACAACAGCGGCGCTCACAGCTGGCTTATGCTGGCTTATACAACTTTCGCACTGAACTTTCGCACTGGCAATCGCAAGAGCAATCGCAAGATGTCGCAGCTGATGCAGCTGATGATGCGAAGTCGTATCGTCGTATCGCGGCTCAGGGATTTACGGATTTACCGTTATGGCCCTAGTTGATGGCCCTAGTTGTCGGCGTCGTCAGCGTCGTCATGACCTACACTGATAAAAGCTAATACTAAGGGCTGCAAATT

Full Affymetrix probeset data:

Annotations for 1629977_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720