FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629978_at:

>probe:Drosophila_2:1629978_at:524:525; Interrogation_Position=282; Antisense; GGGCAGTGCCCATTATTGCGATTTC
>probe:Drosophila_2:1629978_at:250:9; Interrogation_Position=296; Antisense; ATTGCGATTTCATTCCTCTCGTTCA
>probe:Drosophila_2:1629978_at:364:133; Interrogation_Position=320; Antisense; ACCGCCGAAGTGATCACCTGGTTAA
>probe:Drosophila_2:1629978_at:612:453; Interrogation_Position=331; Antisense; GATCACCTGGTTAATTATCGCGTTA
>probe:Drosophila_2:1629978_at:706:105; Interrogation_Position=359; Antisense; AGACATGATGTTTCCTACACTGCCA
>probe:Drosophila_2:1629978_at:164:247; Interrogation_Position=383; Antisense; AATTCGGCACACTACGAATGCCTCG
>probe:Drosophila_2:1629978_at:290:369; Interrogation_Position=398; Antisense; GAATGCCTCGAGACCCGCAGTAGTC
>probe:Drosophila_2:1629978_at:17:349; Interrogation_Position=414; Antisense; GCAGTAGTCTATATTACCCAGCGAA
>probe:Drosophila_2:1629978_at:705:133; Interrogation_Position=429; Antisense; ACCCAGCGAAGTACCTCAAGTTCAT
>probe:Drosophila_2:1629978_at:121:501; Interrogation_Position=469; Antisense; GTGCGAGGTCCCACAAGGTTTGATT
>probe:Drosophila_2:1629978_at:641:157; Interrogation_Position=510; Antisense; ACACAGCCGGGCCATCATTTGATGA
>probe:Drosophila_2:1629978_at:437:485; Interrogation_Position=547; Antisense; GTAGTCTGAATATCCAATCCGATCT
>probe:Drosophila_2:1629978_at:348:665; Interrogation_Position=582; Antisense; TACACCCTGGTTACTTGATATGCGA
>probe:Drosophila_2:1629978_at:42:167; Interrogation_Position=621; Antisense; AAATCGACTTTCATACTTGCTGGCC

Paste this into a BLAST search page for me
GGGCAGTGCCCATTATTGCGATTTCATTGCGATTTCATTCCTCTCGTTCAACCGCCGAAGTGATCACCTGGTTAAGATCACCTGGTTAATTATCGCGTTAAGACATGATGTTTCCTACACTGCCAAATTCGGCACACTACGAATGCCTCGGAATGCCTCGAGACCCGCAGTAGTCGCAGTAGTCTATATTACCCAGCGAAACCCAGCGAAGTACCTCAAGTTCATGTGCGAGGTCCCACAAGGTTTGATTACACAGCCGGGCCATCATTTGATGAGTAGTCTGAATATCCAATCCGATCTTACACCCTGGTTACTTGATATGCGAAAATCGACTTTCATACTTGCTGGCC

Full Affymetrix probeset data:

Annotations for 1629978_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720