FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629981_at:

>probe:Drosophila_2:1629981_at:309:581; Interrogation_Position=1858; Antisense; TGGCCGGTGGCCAACTCGATGCGAT
>probe:Drosophila_2:1629981_at:493:637; Interrogation_Position=1873; Antisense; TCGATGCGATCGGTGCTGGCCAATG
>probe:Drosophila_2:1629981_at:497:97; Interrogation_Position=1905; Antisense; AGAGGATGTTGCCAGCTACGACCGT
>probe:Drosophila_2:1629981_at:712:513; Interrogation_Position=1928; Antisense; GTGTCCGTGCTAACGTTTCCAGCCA
>probe:Drosophila_2:1629981_at:424:71; Interrogation_Position=1972; Antisense; AGTGGCACGCCCAGTACGGGCTTTA
>probe:Drosophila_2:1629981_at:50:279; Interrogation_Position=2052; Antisense; CTAGGCGGGAGCTTCAACTTCGAAT
>probe:Drosophila_2:1629981_at:459:191; Interrogation_Position=2067; Antisense; AACTTCGAATCGGACTGGCTTGGCT
>probe:Drosophila_2:1629981_at:81:143; Interrogation_Position=2080; Antisense; ACTGGCTTGGCTTGGATCCTGAGGC
>probe:Drosophila_2:1629981_at:667:99; Interrogation_Position=2132; Antisense; AGAGACTCACAGACTCCGAGCTGCA
>probe:Drosophila_2:1629981_at:308:617; Interrogation_Position=2153; Antisense; TGCACATTCAAACCACACACAGATC
>probe:Drosophila_2:1629981_at:473:97; Interrogation_Position=2173; Antisense; AGATCTGTTCTGCATATCAAGCTTA
>probe:Drosophila_2:1629981_at:533:411; Interrogation_Position=2257; Antisense; GACCTTAGTACATGTCTTTGACTCT
>probe:Drosophila_2:1629981_at:205:147; Interrogation_Position=2277; Antisense; ACTCTATGCGTCTCCTATGTTTAAG
>probe:Drosophila_2:1629981_at:142:659; Interrogation_Position=2302; Antisense; TAAGTTTTTTCACGCTCTACACCCT

Paste this into a BLAST search page for me
TGGCCGGTGGCCAACTCGATGCGATTCGATGCGATCGGTGCTGGCCAATGAGAGGATGTTGCCAGCTACGACCGTGTGTCCGTGCTAACGTTTCCAGCCAAGTGGCACGCCCAGTACGGGCTTTACTAGGCGGGAGCTTCAACTTCGAATAACTTCGAATCGGACTGGCTTGGCTACTGGCTTGGCTTGGATCCTGAGGCAGAGACTCACAGACTCCGAGCTGCATGCACATTCAAACCACACACAGATCAGATCTGTTCTGCATATCAAGCTTAGACCTTAGTACATGTCTTTGACTCTACTCTATGCGTCTCCTATGTTTAAGTAAGTTTTTTCACGCTCTACACCCT

Full Affymetrix probeset data:

Annotations for 1629981_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720