FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629983_at:

>probe:Drosophila_2:1629983_at:646:427; Interrogation_Position=2563; Antisense; GAGTAGGAGCCGCACGCAGAAACTT
>probe:Drosophila_2:1629983_at:592:55; Interrogation_Position=2644; Antisense; ATGAAACAATTTGCTGCCACCGCAC
>probe:Drosophila_2:1629983_at:140:545; Interrogation_Position=2766; Antisense; GGATAATTCCAAGCCAGTTGGCCTT
>probe:Drosophila_2:1629983_at:418:95; Interrogation_Position=2781; Antisense; AGTTGGCCTTTCTCACATGATATGG
>probe:Drosophila_2:1629983_at:586:347; Interrogation_Position=2824; Antisense; GAATTCGAAAAGCTTCCATGTTTCA
>probe:Drosophila_2:1629983_at:440:245; Interrogation_Position=2904; Antisense; AATTGAGGCCAACTGGCGCCAGGTT
>probe:Drosophila_2:1629983_at:460:577; Interrogation_Position=2918; Antisense; GGCGCCAGGTTTTATCCACAGATTG
>probe:Drosophila_2:1629983_at:395:627; Interrogation_Position=2932; Antisense; TCCACAGATTGCTTCATTGTTCCCA
>probe:Drosophila_2:1629983_at:588:3; Interrogation_Position=2947; Antisense; ATTGTTCCCACACTCTTTCAGTAAC
>probe:Drosophila_2:1629983_at:170:641; Interrogation_Position=2960; Antisense; TCTTTCAGTAACACCAGCTGCTTGC
>probe:Drosophila_2:1629983_at:57:285; Interrogation_Position=2977; Antisense; CTGCTTGCCCTTTGTTGATATTGTT
>probe:Drosophila_2:1629983_at:624:657; Interrogation_Position=3001; Antisense; TAACTAGCAGGCGTGGCGATTCTAA
>probe:Drosophila_2:1629983_at:374:495; Interrogation_Position=3046; Antisense; GTCAGCATGCTGTATCCATAGAATA
>probe:Drosophila_2:1629983_at:629:239; Interrogation_Position=3071; Antisense; AATCACTTCGTGTCGCAGTTTCGGA

Paste this into a BLAST search page for me
GAGTAGGAGCCGCACGCAGAAACTTATGAAACAATTTGCTGCCACCGCACGGATAATTCCAAGCCAGTTGGCCTTAGTTGGCCTTTCTCACATGATATGGGAATTCGAAAAGCTTCCATGTTTCAAATTGAGGCCAACTGGCGCCAGGTTGGCGCCAGGTTTTATCCACAGATTGTCCACAGATTGCTTCATTGTTCCCAATTGTTCCCACACTCTTTCAGTAACTCTTTCAGTAACACCAGCTGCTTGCCTGCTTGCCCTTTGTTGATATTGTTTAACTAGCAGGCGTGGCGATTCTAAGTCAGCATGCTGTATCCATAGAATAAATCACTTCGTGTCGCAGTTTCGGA

Full Affymetrix probeset data:

Annotations for 1629983_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720