Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629984_s_at:

>probe:Drosophila_2:1629984_s_at:511:459; Interrogation_Position=119; Antisense; GATTTTCTTAATAAGGCACGCCGTT
>probe:Drosophila_2:1629984_s_at:113:33; Interrogation_Position=129; Antisense; ATAAGGCACGCCGTTCTGATGCGCG
>probe:Drosophila_2:1629984_s_at:129:719; Interrogation_Position=13; Antisense; TTCCTTTCCTTCTATCTACTTGAAC
>probe:Drosophila_2:1629984_s_at:222:471; Interrogation_Position=141; Antisense; GTTCTGATGCGCGTGCTGTAAAAAT
>probe:Drosophila_2:1629984_s_at:641:657; Interrogation_Position=193; Antisense; TAAGATCCGTTGTTCGAGGTTCCTT
>probe:Drosophila_2:1629984_s_at:525:597; Interrogation_Position=203; Antisense; TGTTCGAGGTTCCTTTACACCCTTG
>probe:Drosophila_2:1629984_s_at:318:663; Interrogation_Position=218; Antisense; TACACCCTTGTCGTACAGGATAAAG
>probe:Drosophila_2:1629984_s_at:418:245; Interrogation_Position=256; Antisense; AATTAAGCAGTCTTTACCGCCTGGA
>probe:Drosophila_2:1629984_s_at:246:87; Interrogation_Position=264; Antisense; AGTCTTTACCGCCTGGACTACAAGT
>probe:Drosophila_2:1629984_s_at:594:439; Interrogation_Position=315; Antisense; GATGGCAGTGCCTCAATATTTCTAC
>probe:Drosophila_2:1629984_s_at:304:507; Interrogation_Position=322; Antisense; GTGCCTCAATATTTCTACTGCTAAG
>probe:Drosophila_2:1629984_s_at:550:225; Interrogation_Position=344; Antisense; AAGGAATACATTTTGGTTCGCGATA
>probe:Drosophila_2:1629984_s_at:403:589; Interrogation_Position=357; Antisense; TGGTTCGCGATAAATTTGTTTCTGA
>probe:Drosophila_2:1629984_s_at:58:727; Interrogation_Position=82; Antisense; TTGGATTAATATGCCACGGGAAATT

Paste this into a BLAST search page for me
GATTTTCTTAATAAGGCACGCCGTTATAAGGCACGCCGTTCTGATGCGCGTTCCTTTCCTTCTATCTACTTGAACGTTCTGATGCGCGTGCTGTAAAAATTAAGATCCGTTGTTCGAGGTTCCTTTGTTCGAGGTTCCTTTACACCCTTGTACACCCTTGTCGTACAGGATAAAGAATTAAGCAGTCTTTACCGCCTGGAAGTCTTTACCGCCTGGACTACAAGTGATGGCAGTGCCTCAATATTTCTACGTGCCTCAATATTTCTACTGCTAAGAAGGAATACATTTTGGTTCGCGATATGGTTCGCGATAAATTTGTTTCTGATTGGATTAATATGCCACGGGAAATT

Full Affymetrix probeset data:

Annotations for 1629984_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime