FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629985_at:

>probe:Drosophila_2:1629985_at:622:373; Interrogation_Position=1076; Antisense; GAAGTCATAGCCACCATGAGTCAGA
>probe:Drosophila_2:1629985_at:257:431; Interrogation_Position=1093; Antisense; GAGTCAGAGGTTTTCTACACCAGAT
>probe:Drosophila_2:1629985_at:151:257; Interrogation_Position=1136; Antisense; CAAAGGATTCCGCACCAGACGAGGA
>probe:Drosophila_2:1629985_at:609:145; Interrogation_Position=598; Antisense; ACATTGTACCTCTTCGGCGAACTTC
>probe:Drosophila_2:1629985_at:488:269; Interrogation_Position=630; Antisense; CATGACGTCCAGAAAGAGCTCCTTA
>probe:Drosophila_2:1629985_at:453:547; Interrogation_Position=687; Antisense; GGATGACTCCTTCATTGAGCAGCTG
>probe:Drosophila_2:1629985_at:562:615; Interrogation_Position=731; Antisense; TGAATGCACTGCAGTTGTCCCTGAA
>probe:Drosophila_2:1629985_at:159:191; Interrogation_Position=754; Antisense; AACATAGTTGTCTACGCCGTGATCA
>probe:Drosophila_2:1629985_at:680:513; Interrogation_Position=772; Antisense; GTGATCAATCCATCGTTTATGCCGG
>probe:Drosophila_2:1629985_at:71:705; Interrogation_Position=788; Antisense; TTATGCCGGAGTTTTTCCTGTGTCT
>probe:Drosophila_2:1629985_at:156:223; Interrogation_Position=814; Antisense; AAGGGAACCTCCGATGTGTGCTTCG
>probe:Drosophila_2:1629985_at:489:691; Interrogation_Position=840; Antisense; TTTGTGTTGTTTCCGGGCTGTAAGA
>probe:Drosophila_2:1629985_at:682:533; Interrogation_Position=924; Antisense; GGTGAGCAGTGTGACTCCACAACAT
>probe:Drosophila_2:1629985_at:374:595; Interrogation_Position=988; Antisense; TGGGCCAGTGACTCCAGCTGCAAAA

Paste this into a BLAST search page for me
GAAGTCATAGCCACCATGAGTCAGAGAGTCAGAGGTTTTCTACACCAGATCAAAGGATTCCGCACCAGACGAGGAACATTGTACCTCTTCGGCGAACTTCCATGACGTCCAGAAAGAGCTCCTTAGGATGACTCCTTCATTGAGCAGCTGTGAATGCACTGCAGTTGTCCCTGAAAACATAGTTGTCTACGCCGTGATCAGTGATCAATCCATCGTTTATGCCGGTTATGCCGGAGTTTTTCCTGTGTCTAAGGGAACCTCCGATGTGTGCTTCGTTTGTGTTGTTTCCGGGCTGTAAGAGGTGAGCAGTGTGACTCCACAACATTGGGCCAGTGACTCCAGCTGCAAAA

Full Affymetrix probeset data:

Annotations for 1629985_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720