FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629988_at:

>probe:Drosophila_2:1629988_at:607:53; Interrogation_Position=13; Antisense; ATGAAGCACACGTCGCCCAGTGAAG
>probe:Drosophila_2:1629988_at:77:333; Interrogation_Position=155; Antisense; GCTGGACGCTGTGCCTCTGGACGCT
>probe:Drosophila_2:1629988_at:487:625; Interrogation_Position=166; Antisense; TGCCTCTGGACGCTGGTGATCGCCA
>probe:Drosophila_2:1629988_at:310:287; Interrogation_Position=178; Antisense; CTGGTGATCGCCAGCGGCTGTTTAA
>probe:Drosophila_2:1629988_at:382:633; Interrogation_Position=185; Antisense; TCGCCAGCGGCTGTTTAATGCTCAA
>probe:Drosophila_2:1629988_at:366:571; Interrogation_Position=193; Antisense; GGCTGTTTAATGCTCAACGCACCGA
>probe:Drosophila_2:1629988_at:338:53; Interrogation_Position=202; Antisense; ATGCTCAACGCACCGACGACGATGG
>probe:Drosophila_2:1629988_at:132:133; Interrogation_Position=213; Antisense; ACCGACGACGATGGCATTTGATATC
>probe:Drosophila_2:1629988_at:289:67; Interrogation_Position=223; Antisense; ATGGCATTTGATATCGGTGAGTACC
>probe:Drosophila_2:1629988_at:199:459; Interrogation_Position=232; Antisense; GATATCGGTGAGTACCGGGTCCAGT
>probe:Drosophila_2:1629988_at:434:537; Interrogation_Position=240; Antisense; TGAGTACCGGGTCCAGTTGAATTGA
>probe:Drosophila_2:1629988_at:411:85; Interrogation_Position=31; Antisense; AGTGAAGCGACCTTCTCCAGCAACA
>probe:Drosophila_2:1629988_at:30:205; Interrogation_Position=35; Antisense; AAGCGACCTTCTCCAGCAACATCAG
>probe:Drosophila_2:1629988_at:84:189; Interrogation_Position=52; Antisense; AACATCAGCATGTTCTCCCGCCAGT

Paste this into a BLAST search page for me
ATGAAGCACACGTCGCCCAGTGAAGGCTGGACGCTGTGCCTCTGGACGCTTGCCTCTGGACGCTGGTGATCGCCACTGGTGATCGCCAGCGGCTGTTTAATCGCCAGCGGCTGTTTAATGCTCAAGGCTGTTTAATGCTCAACGCACCGAATGCTCAACGCACCGACGACGATGGACCGACGACGATGGCATTTGATATCATGGCATTTGATATCGGTGAGTACCGATATCGGTGAGTACCGGGTCCAGTTGAGTACCGGGTCCAGTTGAATTGAAGTGAAGCGACCTTCTCCAGCAACAAAGCGACCTTCTCCAGCAACATCAGAACATCAGCATGTTCTCCCGCCAGT

Full Affymetrix probeset data:

Annotations for 1629988_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720