FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629990_at:

>probe:Drosophila_2:1629990_at:518:447; Interrogation_Position=1037; Antisense; GATGCCTTTAGTCCGCAGAATCTGG
>probe:Drosophila_2:1629990_at:394:331; Interrogation_Position=1106; Antisense; GCGGCTATTGGCATTGTCACGAGTT
>probe:Drosophila_2:1629990_at:659:495; Interrogation_Position=1121; Antisense; GTCACGAGTTTCTTCCTCAAGTACA
>probe:Drosophila_2:1629990_at:638:383; Interrogation_Position=1147; Antisense; GAACTCCATTCTAAAGACCTTCGCG
>probe:Drosophila_2:1629990_at:150:551; Interrogation_Position=1180; Antisense; GGAGTTGCTCTTCACGGCAGTCCTA
>probe:Drosophila_2:1629990_at:26:19; Interrogation_Position=1229; Antisense; ATTTACATGAACACCGCGCTGGCCA
>probe:Drosophila_2:1629990_at:333:655; Interrogation_Position=1303; Antisense; TAATTTGGGCAAGGTGCGTCCGCTG
>probe:Drosophila_2:1629990_at:191:329; Interrogation_Position=1318; Antisense; GCGTCCGCTGTCCAATTTAAGTGAT
>probe:Drosophila_2:1629990_at:124:563; Interrogation_Position=1384; Antisense; GGAAGCGGCAGAATCGGACCTCGAT
>probe:Drosophila_2:1629990_at:573:365; Interrogation_Position=835; Antisense; GAACATGTCCGGCTTCGATTTTAGC
>probe:Drosophila_2:1629990_at:367:461; Interrogation_Position=851; Antisense; GATTTTAGCCTGAGTGCCGTCTTCA
>probe:Drosophila_2:1629990_at:99:163; Interrogation_Position=887; Antisense; ACAATTTGCTCTTGTCTGGCGGGCG
>probe:Drosophila_2:1629990_at:681:369; Interrogation_Position=967; Antisense; GAATGTCTTCATGTACCTGGACTCG
>probe:Drosophila_2:1629990_at:632:305; Interrogation_Position=982; Antisense; CCTGGACTCGATTGTCTGCAATGCA

Paste this into a BLAST search page for me
GATGCCTTTAGTCCGCAGAATCTGGGCGGCTATTGGCATTGTCACGAGTTGTCACGAGTTTCTTCCTCAAGTACAGAACTCCATTCTAAAGACCTTCGCGGGAGTTGCTCTTCACGGCAGTCCTAATTTACATGAACACCGCGCTGGCCATAATTTGGGCAAGGTGCGTCCGCTGGCGTCCGCTGTCCAATTTAAGTGATGGAAGCGGCAGAATCGGACCTCGATGAACATGTCCGGCTTCGATTTTAGCGATTTTAGCCTGAGTGCCGTCTTCAACAATTTGCTCTTGTCTGGCGGGCGGAATGTCTTCATGTACCTGGACTCGCCTGGACTCGATTGTCTGCAATGCA

Full Affymetrix probeset data:

Annotations for 1629990_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720