Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629994_at:

>probe:Drosophila_2:1629994_at:91:315; Interrogation_Position=2563; Antisense; GCCATGCTGATGCTTCTGTGGATGA
>probe:Drosophila_2:1629994_at:623:275; Interrogation_Position=2575; Antisense; CTTCTGTGGATGAGGCTGAGTCTGA
>probe:Drosophila_2:1629994_at:11:213; Interrogation_Position=2635; Antisense; AAGAGCCGGCAATCAAGTATTCCTA
>probe:Drosophila_2:1629994_at:531:215; Interrogation_Position=2649; Antisense; AAGTATTCCTACAGATTCCCTCGGA
>probe:Drosophila_2:1629994_at:398:401; Interrogation_Position=2678; Antisense; GACATCGACATCTCTTTCTCTCTTG
>probe:Drosophila_2:1629994_at:506:283; Interrogation_Position=2704; Antisense; CTGCGTTCTTGTTGTTCGTTTCCGT
>probe:Drosophila_2:1629994_at:434:519; Interrogation_Position=2739; Antisense; GTGGTCCCATCTCCAATGTATTGGA
>probe:Drosophila_2:1629994_at:562:135; Interrogation_Position=2776; Antisense; ACGCACGCATACATATTGCCGGAGG
>probe:Drosophila_2:1629994_at:283:633; Interrogation_Position=2805; Antisense; TCCCGCTGCCTCAAATATCATTTGC
>probe:Drosophila_2:1629994_at:114:23; Interrogation_Position=2819; Antisense; ATATCATTTGCATACGTATCAGGAA
>probe:Drosophila_2:1629994_at:636:289; Interrogation_Position=2833; Antisense; CGTATCAGGAAACGCGTTGTTCCCA
>probe:Drosophila_2:1629994_at:151:145; Interrogation_Position=2894; Antisense; ACTCCCTGCTCCCTAATGAAAGTAA
>probe:Drosophila_2:1629994_at:408:243; Interrogation_Position=2939; Antisense; AATTGAATGCCAAGCCCTACCATTT
>probe:Drosophila_2:1629994_at:624:631; Interrogation_Position=2965; Antisense; TCCCCAGCCCCAAATAATGTTACAT

Paste this into a BLAST search page for me
GCCATGCTGATGCTTCTGTGGATGACTTCTGTGGATGAGGCTGAGTCTGAAAGAGCCGGCAATCAAGTATTCCTAAAGTATTCCTACAGATTCCCTCGGAGACATCGACATCTCTTTCTCTCTTGCTGCGTTCTTGTTGTTCGTTTCCGTGTGGTCCCATCTCCAATGTATTGGAACGCACGCATACATATTGCCGGAGGTCCCGCTGCCTCAAATATCATTTGCATATCATTTGCATACGTATCAGGAACGTATCAGGAAACGCGTTGTTCCCAACTCCCTGCTCCCTAATGAAAGTAAAATTGAATGCCAAGCCCTACCATTTTCCCCAGCCCCAAATAATGTTACAT

Full Affymetrix probeset data:

Annotations for 1629994_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime