FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629995_at:

>probe:Drosophila_2:1629995_at:70:145; Interrogation_Position=3153; Antisense; ACTGCAGATTGTTAGCCCGCTGGAA
>probe:Drosophila_2:1629995_at:326:607; Interrogation_Position=3191; Antisense; TGATGATTGCCTTCATGGGCCCGGA
>probe:Drosophila_2:1629995_at:23:153; Interrogation_Position=3219; Antisense; ACAGTTCCTGGCTCCGGATTTGCAT
>probe:Drosophila_2:1629995_at:64:119; Interrogation_Position=3245; Antisense; AGCTGCTTCGTGATTGCCTGATGGA
>probe:Drosophila_2:1629995_at:361:231; Interrogation_Position=3283; Antisense; AATGCAGCCCATGAATTTGACTTTG
>probe:Drosophila_2:1629995_at:110:91; Interrogation_Position=3331; Antisense; AGATTTGAACCGCTTTACTACCTGT
>probe:Drosophila_2:1629995_at:27:691; Interrogation_Position=3355; Antisense; TTTGTCGAACACTTTGAGGCGGCCA
>probe:Drosophila_2:1629995_at:35:195; Interrogation_Position=3392; Antisense; AACTGTTTAGTTCTCTGGTGCTGGT
>probe:Drosophila_2:1629995_at:550:71; Interrogation_Position=3451; Antisense; AGGCGTCTTTGGTCGGAGCATGTTC
>probe:Drosophila_2:1629995_at:567:115; Interrogation_Position=3467; Antisense; AGCATGTTCAGGCTGTGCGTTTCAT
>probe:Drosophila_2:1629995_at:486:645; Interrogation_Position=3524; Antisense; TCTTTGCGTATTTGGAGCCCGTGGA
>probe:Drosophila_2:1629995_at:592:541; Interrogation_Position=3600; Antisense; GGTTCGTCCTGGAAGCATTGCCTAT
>probe:Drosophila_2:1629995_at:526:659; Interrogation_Position=3645; Antisense; TAACCACTCGAAGTCGGTGCACAAA
>probe:Drosophila_2:1629995_at:256:27; Interrogation_Position=3709; Antisense; ATAGCTCTTCACGAGACTGCGATAA

Paste this into a BLAST search page for me
ACTGCAGATTGTTAGCCCGCTGGAATGATGATTGCCTTCATGGGCCCGGAACAGTTCCTGGCTCCGGATTTGCATAGCTGCTTCGTGATTGCCTGATGGAAATGCAGCCCATGAATTTGACTTTGAGATTTGAACCGCTTTACTACCTGTTTTGTCGAACACTTTGAGGCGGCCAAACTGTTTAGTTCTCTGGTGCTGGTAGGCGTCTTTGGTCGGAGCATGTTCAGCATGTTCAGGCTGTGCGTTTCATTCTTTGCGTATTTGGAGCCCGTGGAGGTTCGTCCTGGAAGCATTGCCTATTAACCACTCGAAGTCGGTGCACAAAATAGCTCTTCACGAGACTGCGATAA

Full Affymetrix probeset data:

Annotations for 1629995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720