FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629996_at:

>probe:Drosophila_2:1629996_at:449:265; Interrogation_Position=1161; Antisense; CAGAGCCATCTGCAAATGTTGGATA
>probe:Drosophila_2:1629996_at:46:73; Interrogation_Position=1190; Antisense; AGGAAACTCTATATACTCGTTGAAG
>probe:Drosophila_2:1629996_at:604:95; Interrogation_Position=1213; Antisense; AGATCACCATCTTCGACAGTTTGAA
>probe:Drosophila_2:1629996_at:237:351; Interrogation_Position=1244; Antisense; GCAGTATTTCTACTTTCAGCAGAAC
>probe:Drosophila_2:1629996_at:58:161; Interrogation_Position=1267; Antisense; ACAACTGGAACTGCGATTTCCTGCA
>probe:Drosophila_2:1629996_at:395:327; Interrogation_Position=1279; Antisense; GCGATTTCCTGCAACTTCTAATGAG
>probe:Drosophila_2:1629996_at:698:225; Interrogation_Position=1320; Antisense; AAGGACATTTCCTTCATGGAGGATA
>probe:Drosophila_2:1629996_at:335:583; Interrogation_Position=1336; Antisense; TGGAGGATATAACAGCACCCGAATT
>probe:Drosophila_2:1629996_at:520:293; Interrogation_Position=1367; Antisense; CGATTATGTGGATGGCATTGCCTGT
>probe:Drosophila_2:1629996_at:109:275; Interrogation_Position=1382; Antisense; CATTGCCTGTTGGTATGAGAGCGAC
>probe:Drosophila_2:1629996_at:472:547; Interrogation_Position=1439; Antisense; GGATGCTGCCATGGAACTCTCGGTG
>probe:Drosophila_2:1629996_at:194:97; Interrogation_Position=1474; Antisense; AGATCAAGACATTCACCGAGTTGGT
>probe:Drosophila_2:1629996_at:105:109; Interrogation_Position=1504; Antisense; AGAAGTTCGTCAAGGTCTATCGCAT
>probe:Drosophila_2:1629996_at:503:663; Interrogation_Position=1718; Antisense; TAAAGCACTTTTTGGAACTCTAGGG

Paste this into a BLAST search page for me
CAGAGCCATCTGCAAATGTTGGATAAGGAAACTCTATATACTCGTTGAAGAGATCACCATCTTCGACAGTTTGAAGCAGTATTTCTACTTTCAGCAGAACACAACTGGAACTGCGATTTCCTGCAGCGATTTCCTGCAACTTCTAATGAGAAGGACATTTCCTTCATGGAGGATATGGAGGATATAACAGCACCCGAATTCGATTATGTGGATGGCATTGCCTGTCATTGCCTGTTGGTATGAGAGCGACGGATGCTGCCATGGAACTCTCGGTGAGATCAAGACATTCACCGAGTTGGTAGAAGTTCGTCAAGGTCTATCGCATTAAAGCACTTTTTGGAACTCTAGGG

Full Affymetrix probeset data:

Annotations for 1629996_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720