Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630000_at:

>probe:Drosophila_2:1630000_at:190:637; Interrogation_Position=3363; Antisense; TCGACTATCGCGAATTCCTGGCCAG
>probe:Drosophila_2:1630000_at:623:617; Interrogation_Position=3417; Antisense; TGCAGATGGGTCTTCGCAGCGCCGC
>probe:Drosophila_2:1630000_at:106:309; Interrogation_Position=3451; Antisense; CCAGCGTTTGGTGGGCAATGTCTGC
>probe:Drosophila_2:1630000_at:320:251; Interrogation_Position=3466; Antisense; CAATGTCTGCGGTCCGGGAAGCCGA
>probe:Drosophila_2:1630000_at:513:117; Interrogation_Position=3490; Antisense; AGCTCTGAGTGCTCGCCAGGATTTG
>probe:Drosophila_2:1630000_at:691:289; Interrogation_Position=3535; Antisense; CGGATTGCCAGCACGCGAATGCGAG
>probe:Drosophila_2:1630000_at:708:525; Interrogation_Position=3589; Antisense; GGGACTGCGAAACCTGGCAATGCAA
>probe:Drosophila_2:1630000_at:50:55; Interrogation_Position=3608; Antisense; ATGCAAATGTTCCAGCGCAGGCTTC
>probe:Drosophila_2:1630000_at:292:263; Interrogation_Position=3620; Antisense; CAGCGCAGGCTTCTGGATGTCAAAT
>probe:Drosophila_2:1630000_at:673:597; Interrogation_Position=3637; Antisense; TGTCAAATGAGATCCGATGCCCGGC
>probe:Drosophila_2:1630000_at:403:101; Interrogation_Position=3670; Antisense; AGAGCTGCGTTACCGAAAGCCACGT
>probe:Drosophila_2:1630000_at:533:173; Interrogation_Position=3685; Antisense; AAAGCCACGTCACTATCGACTGGAT
>probe:Drosophila_2:1630000_at:186:23; Interrogation_Position=3708; Antisense; ATATACAGATCTTTATGGGCGTGGA
>probe:Drosophila_2:1630000_at:376:323; Interrogation_Position=3743; Antisense; GCGACGAAACGAGACCACTACTAGG

Paste this into a BLAST search page for me
TCGACTATCGCGAATTCCTGGCCAGTGCAGATGGGTCTTCGCAGCGCCGCCCAGCGTTTGGTGGGCAATGTCTGCCAATGTCTGCGGTCCGGGAAGCCGAAGCTCTGAGTGCTCGCCAGGATTTGCGGATTGCCAGCACGCGAATGCGAGGGGACTGCGAAACCTGGCAATGCAAATGCAAATGTTCCAGCGCAGGCTTCCAGCGCAGGCTTCTGGATGTCAAATTGTCAAATGAGATCCGATGCCCGGCAGAGCTGCGTTACCGAAAGCCACGTAAAGCCACGTCACTATCGACTGGATATATACAGATCTTTATGGGCGTGGAGCGACGAAACGAGACCACTACTAGG

Full Affymetrix probeset data:

Annotations for 1630000_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime