FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630003_at:

>probe:Drosophila_2:1630003_at:24:565; Interrogation_Position=133; Antisense; GGAATACACATTTCGGCGCTGCAGA
>probe:Drosophila_2:1630003_at:41:97; Interrogation_Position=155; Antisense; AGATCTTGGGAAGCGTGGTCCTCAT
>probe:Drosophila_2:1630003_at:586:591; Interrogation_Position=170; Antisense; TGGTCCTCATCGTTGGAGCCATAAA
>probe:Drosophila_2:1630003_at:109:253; Interrogation_Position=204; Antisense; CAAGTTCTTCGTGCCGTGGATGATA
>probe:Drosophila_2:1630003_at:64:543; Interrogation_Position=235; Antisense; GGATTCTTTTTATACCTGATGGTGA
>probe:Drosophila_2:1630003_at:566:379; Interrogation_Position=258; Antisense; GAACCTGTTCATTTCACTGATAGTC
>probe:Drosophila_2:1630003_at:474:267; Interrogation_Position=283; Antisense; CAGGGCACAGCTTGGATCTTCGGAC
>probe:Drosophila_2:1630003_at:646:129; Interrogation_Position=306; Antisense; ACCATTGATGGTCGTTCCGTTCACA
>probe:Drosophila_2:1630003_at:77:549; Interrogation_Position=34; Antisense; GGAGGAATCATCTGCTCGGGCTGCC
>probe:Drosophila_2:1630003_at:208:625; Interrogation_Position=343; Antisense; TGCGCCCTGTACTCGGTGCAGAAGG
>probe:Drosophila_2:1630003_at:585:621; Interrogation_Position=380; Antisense; TGCGCAAGGAGGAGCCACCGGCATA
>probe:Drosophila_2:1630003_at:584:569; Interrogation_Position=399; Antisense; GGCATATGCCAGCTTGTCCGACAAG
>probe:Drosophila_2:1630003_at:591:27; Interrogation_Position=64; Antisense; ATAGCCTTTGCCATAACCTATCTGG
>probe:Drosophila_2:1630003_at:79:203; Interrogation_Position=78; Antisense; AACCTATCTGGTTTTGATGGACGAT

Paste this into a BLAST search page for me
GGAATACACATTTCGGCGCTGCAGAAGATCTTGGGAAGCGTGGTCCTCATTGGTCCTCATCGTTGGAGCCATAAACAAGTTCTTCGTGCCGTGGATGATAGGATTCTTTTTATACCTGATGGTGAGAACCTGTTCATTTCACTGATAGTCCAGGGCACAGCTTGGATCTTCGGACACCATTGATGGTCGTTCCGTTCACAGGAGGAATCATCTGCTCGGGCTGCCTGCGCCCTGTACTCGGTGCAGAAGGTGCGCAAGGAGGAGCCACCGGCATAGGCATATGCCAGCTTGTCCGACAAGATAGCCTTTGCCATAACCTATCTGGAACCTATCTGGTTTTGATGGACGAT

Full Affymetrix probeset data:

Annotations for 1630003_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720