FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630004_at:

>probe:Drosophila_2:1630004_at:540:561; Interrogation_Position=2026; Antisense; GGAACCTGTTGGAGGCTCGACTTTT
>probe:Drosophila_2:1630004_at:620:423; Interrogation_Position=2122; Antisense; GAGAAACCGTGCTCAGGCTCGGCAA
>probe:Drosophila_2:1630004_at:589:71; Interrogation_Position=2136; Antisense; AGGCTCGGCAATAACGGTACCCACA
>probe:Drosophila_2:1630004_at:299:537; Interrogation_Position=2151; Antisense; GGTACCCACATTTAGCGAATCGATT
>probe:Drosophila_2:1630004_at:296:371; Interrogation_Position=2190; Antisense; GAAGGGTCCTCAGCATACCGAATAT
>probe:Drosophila_2:1630004_at:434:365; Interrogation_Position=2209; Antisense; GAATATACCTACTCACATACACCTA
>probe:Drosophila_2:1630004_at:102:215; Interrogation_Position=2265; Antisense; AATGCATTTCCAAAGACCCGTACTC
>probe:Drosophila_2:1630004_at:180:293; Interrogation_Position=2283; Antisense; CGTACTCCTCTATTCCTAAGTAAAG
>probe:Drosophila_2:1630004_at:314:491; Interrogation_Position=2309; Antisense; GTAAATAGGCATCGAGCACTTCCTC
>probe:Drosophila_2:1630004_at:602:163; Interrogation_Position=2398; Antisense; AAATATATCTACTCTCTAAGCAGGA
>probe:Drosophila_2:1630004_at:569:617; Interrogation_Position=2434; Antisense; TGCTTTCGTTGGGTTTTCGACGATT
>probe:Drosophila_2:1630004_at:35:467; Interrogation_Position=2468; Antisense; GATTGTGGTTTCTAGGCAGATTCAT
>probe:Drosophila_2:1630004_at:434:95; Interrogation_Position=2485; Antisense; AGATTCATTGTTCTGTTCGTCTGTG
>probe:Drosophila_2:1630004_at:75:471; Interrogation_Position=2499; Antisense; GTTCGTCTGTGTCTGTACAACTAAA

Paste this into a BLAST search page for me
GGAACCTGTTGGAGGCTCGACTTTTGAGAAACCGTGCTCAGGCTCGGCAAAGGCTCGGCAATAACGGTACCCACAGGTACCCACATTTAGCGAATCGATTGAAGGGTCCTCAGCATACCGAATATGAATATACCTACTCACATACACCTAAATGCATTTCCAAAGACCCGTACTCCGTACTCCTCTATTCCTAAGTAAAGGTAAATAGGCATCGAGCACTTCCTCAAATATATCTACTCTCTAAGCAGGATGCTTTCGTTGGGTTTTCGACGATTGATTGTGGTTTCTAGGCAGATTCATAGATTCATTGTTCTGTTCGTCTGTGGTTCGTCTGTGTCTGTACAACTAAA

Full Affymetrix probeset data:

Annotations for 1630004_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720