Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630005_at:

>probe:Drosophila_2:1630005_at:75:293; Interrogation_Position=1735; Antisense; CGTCTGCGTGGTGGCGCCATCTAGA
>probe:Drosophila_2:1630005_at:526:589; Interrogation_Position=1743; Antisense; TGGTGGCGCCATCTAGATTTTTTCA
>probe:Drosophila_2:1630005_at:90:523; Interrogation_Position=1745; Antisense; GTGGCGCCATCTAGATTTTTTCACC
>probe:Drosophila_2:1630005_at:365:315; Interrogation_Position=1750; Antisense; GCCATCTAGATTTTTTCACCCTTAT
>probe:Drosophila_2:1630005_at:143:267; Interrogation_Position=1752; Antisense; CATCTAGATTTTTTCACCCTTATAA
>probe:Drosophila_2:1630005_at:660:241; Interrogation_Position=1778; Antisense; AATTGAAGTTAGTTAGTTGTGCCAC
>probe:Drosophila_2:1630005_at:236:215; Interrogation_Position=1783; Antisense; AAGTTAGTTAGTTGTGCCACAGGGC
>probe:Drosophila_2:1630005_at:583:473; Interrogation_Position=1789; Antisense; GTTAGTTGTGCCACAGGGCATAACT
>probe:Drosophila_2:1630005_at:170:629; Interrogation_Position=1797; Antisense; TGCCACAGGGCATAACTCAAGAATT
>probe:Drosophila_2:1630005_at:417:525; Interrogation_Position=1804; Antisense; GGGCATAACTCAAGAATTCATACTA
>probe:Drosophila_2:1630005_at:166:473; Interrogation_Position=1836; Antisense; GTAAATTGGTTTATTCAAAGGCACA
>probe:Drosophila_2:1630005_at:182:255; Interrogation_Position=1851; Antisense; CAAAGGCACAAAATAATCAATCACA
>probe:Drosophila_2:1630005_at:160:257; Interrogation_Position=1872; Antisense; CACAATAATTATTGGTATTCGAAGA
>probe:Drosophila_2:1630005_at:506:163; Interrogation_Position=1900; Antisense; AAATTTTCAATTTGTGTGTTCAATG

Paste this into a BLAST search page for me
CGTCTGCGTGGTGGCGCCATCTAGATGGTGGCGCCATCTAGATTTTTTCAGTGGCGCCATCTAGATTTTTTCACCGCCATCTAGATTTTTTCACCCTTATCATCTAGATTTTTTCACCCTTATAAAATTGAAGTTAGTTAGTTGTGCCACAAGTTAGTTAGTTGTGCCACAGGGCGTTAGTTGTGCCACAGGGCATAACTTGCCACAGGGCATAACTCAAGAATTGGGCATAACTCAAGAATTCATACTAGTAAATTGGTTTATTCAAAGGCACACAAAGGCACAAAATAATCAATCACACACAATAATTATTGGTATTCGAAGAAAATTTTCAATTTGTGTGTTCAATG

Full Affymetrix probeset data:

Annotations for 1630005_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime