FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630006_at:

>probe:Drosophila_2:1630006_at:509:441; Interrogation_Position=1002; Antisense; GATGGATGTGCCAAGGACCTCAACA
>probe:Drosophila_2:1630006_at:527:159; Interrogation_Position=1024; Antisense; ACAAGGCAATTCAGCTGCAGCAGGA
>probe:Drosophila_2:1630006_at:540:539; Interrogation_Position=1156; Antisense; GGTAGAAACACCCACTGAGAGCCAC
>probe:Drosophila_2:1630006_at:558:103; Interrogation_Position=1173; Antisense; AGAGCCACCCATGTTCTATGTGCAA
>probe:Drosophila_2:1630006_at:43:35; Interrogation_Position=619; Antisense; ATCACACGGTGATGCCCATGATCAG
>probe:Drosophila_2:1630006_at:664:109; Interrogation_Position=654; Antisense; AGCAAGTACTATCCCGGCGGACATG
>probe:Drosophila_2:1630006_at:307:67; Interrogation_Position=676; Antisense; ATGGCACCTTCATTGGCTGGATCAA
>probe:Drosophila_2:1630006_at:709:707; Interrogation_Position=747; Antisense; TTCGGACCCCAGATGCAGAAGTATC
>probe:Drosophila_2:1630006_at:435:99; Interrogation_Position=802; Antisense; AGATGATCCAGTTCTGCTGCGCCTT
>probe:Drosophila_2:1630006_at:446:129; Interrogation_Position=832; Antisense; ACCAGACGCAGCTGTTGTACACGGA
>probe:Drosophila_2:1630006_at:363:45; Interrogation_Position=865; Antisense; ATCCCAGGTGGTCGGTGTGCTTTAC
>probe:Drosophila_2:1630006_at:517:199; Interrogation_Position=897; Antisense; AACGCGGTGTTCTTCTACTTCCTGT
>probe:Drosophila_2:1630006_at:163:631; Interrogation_Position=916; Antisense; TCCTGTTCAACGACTTCTACCAGAA
>probe:Drosophila_2:1630006_at:20:423; Interrogation_Position=972; Antisense; GAGAAGGCTCTGTCGGCGGATAACA

Paste this into a BLAST search page for me
GATGGATGTGCCAAGGACCTCAACAACAAGGCAATTCAGCTGCAGCAGGAGGTAGAAACACCCACTGAGAGCCACAGAGCCACCCATGTTCTATGTGCAAATCACACGGTGATGCCCATGATCAGAGCAAGTACTATCCCGGCGGACATGATGGCACCTTCATTGGCTGGATCAATTCGGACCCCAGATGCAGAAGTATCAGATGATCCAGTTCTGCTGCGCCTTACCAGACGCAGCTGTTGTACACGGAATCCCAGGTGGTCGGTGTGCTTTACAACGCGGTGTTCTTCTACTTCCTGTTCCTGTTCAACGACTTCTACCAGAAGAGAAGGCTCTGTCGGCGGATAACA

Full Affymetrix probeset data:

Annotations for 1630006_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720