FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630009_at:

>probe:Drosophila_2:1630009_at:480:75; Interrogation_Position=1011; Antisense; AGGATGGCTTGGTACTTAGTCGACT
>probe:Drosophila_2:1630009_at:75:205; Interrogation_Position=601; Antisense; AAGCCTTATTGTGCTCTTGTTCGTG
>probe:Drosophila_2:1630009_at:497:727; Interrogation_Position=617; Antisense; TTGTTCGTGATGTACCATGCCCAGA
>probe:Drosophila_2:1630009_at:244:269; Interrogation_Position=632; Antisense; CATGCCCAGACGATCAATGGTGGAC
>probe:Drosophila_2:1630009_at:503:229; Interrogation_Position=647; Antisense; AATGGTGGACGCTTTGCCGAGATGC
>probe:Drosophila_2:1630009_at:255:427; Interrogation_Position=665; Antisense; GAGATGCGGCTGAACGATCACCTGT
>probe:Drosophila_2:1630009_at:53:339; Interrogation_Position=733; Antisense; GCTCACCTTCTATGCACAGATTATC
>probe:Drosophila_2:1630009_at:425:461; Interrogation_Position=751; Antisense; GATTATCTACCGGTTCGCTTCGAAT
>probe:Drosophila_2:1630009_at:405:367; Interrogation_Position=772; Antisense; GAATGCCGCGAAAACCACGGGATCT
>probe:Drosophila_2:1630009_at:668:139; Interrogation_Position=788; Antisense; ACGGGATCTCCGTTAGAGGGCAGTT
>probe:Drosophila_2:1630009_at:325:91; Interrogation_Position=809; Antisense; AGTTGGGTTCAGACGACACCGATTA
>probe:Drosophila_2:1630009_at:507:567; Interrogation_Position=893; Antisense; GGCAGTGAGAATTCCCCAGGTGGAA
>probe:Drosophila_2:1630009_at:322:395; Interrogation_Position=915; Antisense; GAAATGCATCATAACCCTCCAAAGG
>probe:Drosophila_2:1630009_at:644:423; Interrogation_Position=966; Antisense; GAGACTACTTTTCTCCAGGAGTAAT

Paste this into a BLAST search page for me
AGGATGGCTTGGTACTTAGTCGACTAAGCCTTATTGTGCTCTTGTTCGTGTTGTTCGTGATGTACCATGCCCAGACATGCCCAGACGATCAATGGTGGACAATGGTGGACGCTTTGCCGAGATGCGAGATGCGGCTGAACGATCACCTGTGCTCACCTTCTATGCACAGATTATCGATTATCTACCGGTTCGCTTCGAATGAATGCCGCGAAAACCACGGGATCTACGGGATCTCCGTTAGAGGGCAGTTAGTTGGGTTCAGACGACACCGATTAGGCAGTGAGAATTCCCCAGGTGGAAGAAATGCATCATAACCCTCCAAAGGGAGACTACTTTTCTCCAGGAGTAAT

Full Affymetrix probeset data:

Annotations for 1630009_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720