FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630011_at:

>probe:Drosophila_2:1630011_at:200:519; Interrogation_Position=148; Antisense; GTGGTACACCCACTCGATATATCCT
>probe:Drosophila_2:1630011_at:649:21; Interrogation_Position=164; Antisense; ATATATCCTCATCTCTCGTTGCGAG
>probe:Drosophila_2:1630011_at:173:251; Interrogation_Position=19; Antisense; CAAGTGGAAGATCTTCGTCCCTGCA
>probe:Drosophila_2:1630011_at:552:661; Interrogation_Position=232; Antisense; TAAATTCAGCGTTGTGGCCCGGGAA
>probe:Drosophila_2:1630011_at:652:721; Interrogation_Position=321; Antisense; TTGGGCGGTATGTTTTGGGCACAAC
>probe:Drosophila_2:1630011_at:418:217; Interrogation_Position=346; Antisense; AAGTACGGCATTTCCTGAGGGCGTT
>probe:Drosophila_2:1630011_at:527:471; Interrogation_Position=368; Antisense; GTTCTCATGTACGTTCTGGATACCG
>probe:Drosophila_2:1630011_at:409:461; Interrogation_Position=392; Antisense; GATTATGTGAACTTCGCCATTCGAT
>probe:Drosophila_2:1630011_at:477:233; Interrogation_Position=43; Antisense; AATCCTATATCTTCAATCCTCCATG
>probe:Drosophila_2:1630011_at:503:3; Interrogation_Position=453; Antisense; ATTGGGCTGTCATCCAGACCCGAAA
>probe:Drosophila_2:1630011_at:173:197; Interrogation_Position=477; Antisense; AACGATTGCCCAGTACTCAGGTTAT
>probe:Drosophila_2:1630011_at:228:507; Interrogation_Position=528; Antisense; GTGCCGGCCTTGTTATAGGTGACAT
>probe:Drosophila_2:1630011_at:293:549; Interrogation_Position=568; Antisense; GGAGTCGTGTCCTTATGATACCTGA
>probe:Drosophila_2:1630011_at:80:599; Interrogation_Position=92; Antisense; TGTCCCTCCAATATGACGGCTGTTG

Paste this into a BLAST search page for me
GTGGTACACCCACTCGATATATCCTATATATCCTCATCTCTCGTTGCGAGCAAGTGGAAGATCTTCGTCCCTGCATAAATTCAGCGTTGTGGCCCGGGAATTGGGCGGTATGTTTTGGGCACAACAAGTACGGCATTTCCTGAGGGCGTTGTTCTCATGTACGTTCTGGATACCGGATTATGTGAACTTCGCCATTCGATAATCCTATATCTTCAATCCTCCATGATTGGGCTGTCATCCAGACCCGAAAAACGATTGCCCAGTACTCAGGTTATGTGCCGGCCTTGTTATAGGTGACATGGAGTCGTGTCCTTATGATACCTGATGTCCCTCCAATATGACGGCTGTTG

Full Affymetrix probeset data:

Annotations for 1630011_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720