FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630012_at:

>probe:Drosophila_2:1630012_at:171:589; Interrogation_Position=1076; Antisense; TGGAGTACCCCATCGATATGAGGAG
>probe:Drosophila_2:1630012_at:345:77; Interrogation_Position=1096; Antisense; AGGAGTCGGTATGCATCCTCATTTC
>probe:Drosophila_2:1630012_at:37:631; Interrogation_Position=1121; Antisense; TCCTGCATGACCTTTTCTTTGATTT
>probe:Drosophila_2:1630012_at:715:209; Interrogation_Position=1217; Antisense; AAGAAGCCCAGCGACATTTCCGGCG
>probe:Drosophila_2:1630012_at:570:277; Interrogation_Position=1244; Antisense; CTTTGTTTCGCTACTCGGAGGAAAT
>probe:Drosophila_2:1630012_at:436:725; Interrogation_Position=1269; Antisense; TTGTGTCCAGAAGCTGTCACTTTTC
>probe:Drosophila_2:1630012_at:727:493; Interrogation_Position=1284; Antisense; GTCACTTTTCTCACTGATTCAGCAA
>probe:Drosophila_2:1630012_at:591:671; Interrogation_Position=1349; Antisense; TACGAATGCACGAAGCCGGACTCAT
>probe:Drosophila_2:1630012_at:72:557; Interrogation_Position=1366; Antisense; GGACTCATTCGCCTATGGTATCGGA
>probe:Drosophila_2:1630012_at:512:527; Interrogation_Position=1433; Antisense; GGGACTTAAGCACAGTTCATCGGGC
>probe:Drosophila_2:1630012_at:202:41; Interrogation_Position=1451; Antisense; ATCGGGCGCAACCAATTCGTTGGAC
>probe:Drosophila_2:1630012_at:432:715; Interrogation_Position=1521; Antisense; TTCTGTGGTTGTTTTCGTCATCGAG
>probe:Drosophila_2:1630012_at:490:637; Interrogation_Position=1541; Antisense; TCGAGCTCACTGTTCACTATGCAAA
>probe:Drosophila_2:1630012_at:348:3; Interrogation_Position=988; Antisense; ATTGGGCCCCAGAAGGTGAATCACA

Paste this into a BLAST search page for me
TGGAGTACCCCATCGATATGAGGAGAGGAGTCGGTATGCATCCTCATTTCTCCTGCATGACCTTTTCTTTGATTTAAGAAGCCCAGCGACATTTCCGGCGCTTTGTTTCGCTACTCGGAGGAAATTTGTGTCCAGAAGCTGTCACTTTTCGTCACTTTTCTCACTGATTCAGCAATACGAATGCACGAAGCCGGACTCATGGACTCATTCGCCTATGGTATCGGAGGGACTTAAGCACAGTTCATCGGGCATCGGGCGCAACCAATTCGTTGGACTTCTGTGGTTGTTTTCGTCATCGAGTCGAGCTCACTGTTCACTATGCAAAATTGGGCCCCAGAAGGTGAATCACA

Full Affymetrix probeset data:

Annotations for 1630012_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720