FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630014_at:

>probe:Drosophila_2:1630014_at:509:653; Interrogation_Position=2695; Antisense; TCAAGTCACATCTTTGGCGCTCAGC
>probe:Drosophila_2:1630014_at:528:3; Interrogation_Position=2731; Antisense; ATTGGCACGGGCATCGGAGTCACAC
>probe:Drosophila_2:1630014_at:178:347; Interrogation_Position=2784; Antisense; GCATCGGTACTGGAAAGCTCGGCAC
>probe:Drosophila_2:1630014_at:22:153; Interrogation_Position=2807; Antisense; ACAGTTGCCCGAGATGCCAATTCGA
>probe:Drosophila_2:1630014_at:577:521; Interrogation_Position=2834; Antisense; GGGCCAGCGAGATACCCAAGTCTGT
>probe:Drosophila_2:1630014_at:546:223; Interrogation_Position=2872; Antisense; AAGGTAGACTTCTTCTGGATCAACA
>probe:Drosophila_2:1630014_at:390:97; Interrogation_Position=2905; Antisense; AGATCCTTCGAGTGGTTCGTCAATC
>probe:Drosophila_2:1630014_at:397:505; Interrogation_Position=2969; Antisense; GTGCCATGGAGCGATTCCTGGACAT
>probe:Drosophila_2:1630014_at:189:507; Interrogation_Position=3011; Antisense; GTGCGCTGCAAAGAACCGACATGAA
>probe:Drosophila_2:1630014_at:286:225; Interrogation_Position=3034; Antisense; AAGGCAGTGGGTCTCCAACTAGCTT
>probe:Drosophila_2:1630014_at:135:147; Interrogation_Position=3051; Antisense; ACTAGCTTTGGACTTACTGCACGAA
>probe:Drosophila_2:1630014_at:612:289; Interrogation_Position=3085; Antisense; CGGGATCTGATCACGGGTCTGAAAA
>probe:Drosophila_2:1630014_at:347:81; Interrogation_Position=3173; Antisense; AGGGAAAGGTCACCGTCTTCTACTG
>probe:Drosophila_2:1630014_at:250:87; Interrogation_Position=3233; Antisense; AGTGCGACCAGTACGGATTTGCCTT

Paste this into a BLAST search page for me
TCAAGTCACATCTTTGGCGCTCAGCATTGGCACGGGCATCGGAGTCACACGCATCGGTACTGGAAAGCTCGGCACACAGTTGCCCGAGATGCCAATTCGAGGGCCAGCGAGATACCCAAGTCTGTAAGGTAGACTTCTTCTGGATCAACAAGATCCTTCGAGTGGTTCGTCAATCGTGCCATGGAGCGATTCCTGGACATGTGCGCTGCAAAGAACCGACATGAAAAGGCAGTGGGTCTCCAACTAGCTTACTAGCTTTGGACTTACTGCACGAACGGGATCTGATCACGGGTCTGAAAAAGGGAAAGGTCACCGTCTTCTACTGAGTGCGACCAGTACGGATTTGCCTT

Full Affymetrix probeset data:

Annotations for 1630014_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720