Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630017_at:

>probe:Drosophila_2:1630017_at:399:435; Interrogation_Position=100; Antisense; GAGGCGGGCAAGAACGTGACCATTC
>probe:Drosophila_2:1630017_at:246:107; Interrogation_Position=110; Antisense; AGAACGTGACCATTCCGTGTCCGGG
>probe:Drosophila_2:1630017_at:308:199; Interrogation_Position=139; Antisense; AACGAGCACTCGCTGGTGGACACGC
>probe:Drosophila_2:1630017_at:521:145; Interrogation_Position=146; Antisense; ACTCGCTGGTGGACACGCTCGTGTG
>probe:Drosophila_2:1630017_at:456:553; Interrogation_Position=15; Antisense; GGAGCATGGAGCACAAACTCAACAT
>probe:Drosophila_2:1630017_at:550:135; Interrogation_Position=160; Antisense; ACGCTCGTGTGGAAGACGGCGTCCA
>probe:Drosophila_2:1630017_at:503:375; Interrogation_Position=171; Antisense; GAAGACGGCGTCCACGACAATCGCA
>probe:Drosophila_2:1630017_at:682:235; Interrogation_Position=189; Antisense; AATCGCACAGTTTGCCAACCGGATA
>probe:Drosophila_2:1630017_at:682:283; Interrogation_Position=217; Antisense; CTGCTCCACAGTCCGAGGGTGAGTA
>probe:Drosophila_2:1630017_at:549:177; Interrogation_Position=29; Antisense; AAACTCAACATGCATTGTCCTCGAA
>probe:Drosophila_2:1630017_at:12:345; Interrogation_Position=40; Antisense; GCATTGTCCTCGAATAATCTCAAGT
>probe:Drosophila_2:1630017_at:688:201; Interrogation_Position=55; Antisense; AATCTCAAGTACGTCACAAATCTGG
>probe:Drosophila_2:1630017_at:670:647; Interrogation_Position=68; Antisense; TCACAAATCTGGACTACGTAAAGGT
>probe:Drosophila_2:1630017_at:641:133; Interrogation_Position=80; Antisense; ACTACGTAAAGGTGAATGCCGAGGC

Paste this into a BLAST search page for me
GAGGCGGGCAAGAACGTGACCATTCAGAACGTGACCATTCCGTGTCCGGGAACGAGCACTCGCTGGTGGACACGCACTCGCTGGTGGACACGCTCGTGTGGGAGCATGGAGCACAAACTCAACATACGCTCGTGTGGAAGACGGCGTCCAGAAGACGGCGTCCACGACAATCGCAAATCGCACAGTTTGCCAACCGGATACTGCTCCACAGTCCGAGGGTGAGTAAAACTCAACATGCATTGTCCTCGAAGCATTGTCCTCGAATAATCTCAAGTAATCTCAAGTACGTCACAAATCTGGTCACAAATCTGGACTACGTAAAGGTACTACGTAAAGGTGAATGCCGAGGC

Full Affymetrix probeset data:

Annotations for 1630017_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime