FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630018_at:

>probe:Drosophila_2:1630018_at:488:209; Interrogation_Position=1018; Antisense; AAGCAGCATCGCATGGGTGATCAAC
>probe:Drosophila_2:1630018_at:561:101; Interrogation_Position=1080; Antisense; AGAGACTCCCAATGATTTCGCCGAG
>probe:Drosophila_2:1630018_at:316:319; Interrogation_Position=1099; Antisense; GCCGAGTTTCTTATCACCGCAGAAG
>probe:Drosophila_2:1630018_at:552:533; Interrogation_Position=1123; Antisense; GGTGTGGTCAATGTTCCAGAGCCAT
>probe:Drosophila_2:1630018_at:562:195; Interrogation_Position=1245; Antisense; AACGGCGGAGCGTTCAATTAGCCAT
>probe:Drosophila_2:1630018_at:253:315; Interrogation_Position=1265; Antisense; GCCATACGATTGTCTTATACTCCTG
>probe:Drosophila_2:1630018_at:49:471; Interrogation_Position=1337; Antisense; GTTGCCAATCAGGTTTAGGTATCAT
>probe:Drosophila_2:1630018_at:268:647; Interrogation_Position=788; Antisense; TCATTATTGATTCTGTGGCCGCCAT
>probe:Drosophila_2:1630018_at:228:421; Interrogation_Position=846; Antisense; GAGACATATGCGTCGACTGGCAGAC
>probe:Drosophila_2:1630018_at:169:643; Interrogation_Position=873; Antisense; TCTGCTCAGCTACGCGGATAAGTAC
>probe:Drosophila_2:1630018_at:46:657; Interrogation_Position=891; Antisense; TAAGTACAACTGTGCCGTGGTCTGT
>probe:Drosophila_2:1630018_at:550:499; Interrogation_Position=910; Antisense; GTCTGTGTGAATCAGGTGGCCACCA
>probe:Drosophila_2:1630018_at:17:429; Interrogation_Position=949; Antisense; GAGATTCCCTGCTTGGGATTGCAGT
>probe:Drosophila_2:1630018_at:652:147; Interrogation_Position=991; Antisense; ACTAGACTGCGTGTTTCCCGGGTGC

Paste this into a BLAST search page for me
AAGCAGCATCGCATGGGTGATCAACAGAGACTCCCAATGATTTCGCCGAGGCCGAGTTTCTTATCACCGCAGAAGGGTGTGGTCAATGTTCCAGAGCCATAACGGCGGAGCGTTCAATTAGCCATGCCATACGATTGTCTTATACTCCTGGTTGCCAATCAGGTTTAGGTATCATTCATTATTGATTCTGTGGCCGCCATGAGACATATGCGTCGACTGGCAGACTCTGCTCAGCTACGCGGATAAGTACTAAGTACAACTGTGCCGTGGTCTGTGTCTGTGTGAATCAGGTGGCCACCAGAGATTCCCTGCTTGGGATTGCAGTACTAGACTGCGTGTTTCCCGGGTGC

Full Affymetrix probeset data:

Annotations for 1630018_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720