FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630020_at:

>probe:Drosophila_2:1630020_at:420:89; Interrogation_Position=15; Antisense; AGTCATCTCTCTGAGTTTATCCCAA
>probe:Drosophila_2:1630020_at:674:271; Interrogation_Position=18; Antisense; CATCTCTCTGAGTTTATCCCAAAAA
>probe:Drosophila_2:1630020_at:637:641; Interrogation_Position=22; Antisense; TCTCTGAGTTTATCCCAAAAACAAC
>probe:Drosophila_2:1630020_at:125:87; Interrogation_Position=358; Antisense; AGTCGTCCACTCTGTGCCTCTGGTC
>probe:Drosophila_2:1630020_at:577:131; Interrogation_Position=434; Antisense; ACCCTGCACCACTAAGGACGCAAAT
>probe:Drosophila_2:1630020_at:555:353; Interrogation_Position=439; Antisense; GCACCACTAAGGACGCAAATGTGAT
>probe:Drosophila_2:1630020_at:425:73; Interrogation_Position=448; Antisense; AGGACGCAAATGTGATACAGTATTT
>probe:Drosophila_2:1630020_at:380:453; Interrogation_Position=461; Antisense; GATACAGTATTTACGATTTTTTGTT
>probe:Drosophila_2:1630020_at:120:653; Interrogation_Position=486; Antisense; TCAATAAATGTTTTTCGTTTTGTCA
>probe:Drosophila_2:1630020_at:114:57; Interrogation_Position=493; Antisense; ATGTTTTTCGTTTTGTCATAACAAG
>probe:Drosophila_2:1630020_at:58:203; Interrogation_Position=56; Antisense; AACCAAACCTAATTCAAGATGTTCA
>probe:Drosophila_2:1630020_at:145:215; Interrogation_Position=71; Antisense; AAGATGTTCAAATTTGTTGCTGTCA
>probe:Drosophila_2:1630020_at:209:257; Interrogation_Position=79; Antisense; CAAATTTGTTGCTGTCATCGCTCTC
>probe:Drosophila_2:1630020_at:128:21; Interrogation_Position=82; Antisense; ATTTGTTGCTGTCATCGCTCTCCTG

Paste this into a BLAST search page for me
AGTCATCTCTCTGAGTTTATCCCAACATCTCTCTGAGTTTATCCCAAAAATCTCTGAGTTTATCCCAAAAACAACAGTCGTCCACTCTGTGCCTCTGGTCACCCTGCACCACTAAGGACGCAAATGCACCACTAAGGACGCAAATGTGATAGGACGCAAATGTGATACAGTATTTGATACAGTATTTACGATTTTTTGTTTCAATAAATGTTTTTCGTTTTGTCAATGTTTTTCGTTTTGTCATAACAAGAACCAAACCTAATTCAAGATGTTCAAAGATGTTCAAATTTGTTGCTGTCACAAATTTGTTGCTGTCATCGCTCTCATTTGTTGCTGTCATCGCTCTCCTG

Full Affymetrix probeset data:

Annotations for 1630020_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720