FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630025_at:

>probe:Drosophila_2:1630025_at:222:377; Interrogation_Position=1137; Antisense; GAAGCTGAATGACCATCACCATCTC
>probe:Drosophila_2:1630025_at:307:39; Interrogation_Position=1157; Antisense; ATCTCAATCACCATCACCATTTGCA
>probe:Drosophila_2:1630025_at:692:19; Interrogation_Position=1175; Antisense; ATTTGCACCATCATCTGGAGCTGGT
>probe:Drosophila_2:1630025_at:288:271; Interrogation_Position=1186; Antisense; CATCTGGAGCTGGTCGATTTCGACA
>probe:Drosophila_2:1630025_at:169:81; Interrogation_Position=1235; Antisense; AGGTGATCATGGACGCCTTGAGGCT
>probe:Drosophila_2:1630025_at:449:305; Interrogation_Position=1250; Antisense; CCTTGAGGCTGGGAACGGCGACACC
>probe:Drosophila_2:1630025_at:37:13; Interrogation_Position=1295; Antisense; ATTCTTGCGGACAGGCGGCGATGAT
>probe:Drosophila_2:1630025_at:696:121; Interrogation_Position=1333; Antisense; AGCGTGTTCCACAATCTGGTGGTCA
>probe:Drosophila_2:1630025_at:334:533; Interrogation_Position=1350; Antisense; GGTGGTCACCTCGTTGGAGACATGA
>probe:Drosophila_2:1630025_at:308:393; Interrogation_Position=1373; Antisense; GAAAGTACCAGTGAATCCCCGAGCA
>probe:Drosophila_2:1630025_at:204:511; Interrogation_Position=1383; Antisense; GTGAATCCCCGAGCAGCAGACAAAG
>probe:Drosophila_2:1630025_at:297:385; Interrogation_Position=862; Antisense; GAACAGCTGGAGAAGGCCGCCTTGT
>probe:Drosophila_2:1630025_at:267:439; Interrogation_Position=952; Antisense; GAGGCTCTGTCCCAGTTCTACATAC
>probe:Drosophila_2:1630025_at:169:275; Interrogation_Position=999; Antisense; CATTGAGGAGTGTCCCCTGGATGTG

Paste this into a BLAST search page for me
GAAGCTGAATGACCATCACCATCTCATCTCAATCACCATCACCATTTGCAATTTGCACCATCATCTGGAGCTGGTCATCTGGAGCTGGTCGATTTCGACAAGGTGATCATGGACGCCTTGAGGCTCCTTGAGGCTGGGAACGGCGACACCATTCTTGCGGACAGGCGGCGATGATAGCGTGTTCCACAATCTGGTGGTCAGGTGGTCACCTCGTTGGAGACATGAGAAAGTACCAGTGAATCCCCGAGCAGTGAATCCCCGAGCAGCAGACAAAGGAACAGCTGGAGAAGGCCGCCTTGTGAGGCTCTGTCCCAGTTCTACATACCATTGAGGAGTGTCCCCTGGATGTG

Full Affymetrix probeset data:

Annotations for 1630025_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720