FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630028_at:

>probe:Drosophila_2:1630028_at:60:633; Interrogation_Position=103; Antisense; TCCGCGTCGTTTAGCTTGACTTTTA
>probe:Drosophila_2:1630028_at:359:185; Interrogation_Position=133; Antisense; AACACTTCGATTGTTTCGCGTAGCA
>probe:Drosophila_2:1630028_at:728:289; Interrogation_Position=151; Antisense; CGTAGCAATAGTCGCACAATTTTTG
>probe:Drosophila_2:1630028_at:186:377; Interrogation_Position=175; Antisense; GAAGCTTTCAAGGAGTTCCTGGATT
>probe:Drosophila_2:1630028_at:263:113; Interrogation_Position=19; Antisense; AGCACGGAAGATTCTTGCGGACACA
>probe:Drosophila_2:1630028_at:690:719; Interrogation_Position=190; Antisense; TTCCTGGATTTTTGGGATATCGGCA
>probe:Drosophila_2:1630028_at:100:459; Interrogation_Position=205; Antisense; GATATCGGCAACGAAGTTTCTGCAG
>probe:Drosophila_2:1630028_at:457:99; Interrogation_Position=228; Antisense; AGAGTCAGCAGTTCGGGTCTCCAGC
>probe:Drosophila_2:1630028_at:568:531; Interrogation_Position=242; Antisense; GGGTCTCCAGCAACGGAGCTTTCAA
>probe:Drosophila_2:1630028_at:310:419; Interrogation_Position=257; Antisense; GAGCTTTCAACTTGCCGCAGAGTTT
>probe:Drosophila_2:1630028_at:729:519; Interrogation_Position=322; Antisense; GTGGATCCAGCCTACGGAGGCAACA
>probe:Drosophila_2:1630028_at:384:357; Interrogation_Position=431; Antisense; GCAACAAATTCGTCTGCCACAAGGG
>probe:Drosophila_2:1630028_at:277:693; Interrogation_Position=73; Antisense; TTTGAGTGCACAGCCATGAGTCTTC
>probe:Drosophila_2:1630028_at:607:57; Interrogation_Position=88; Antisense; ATGAGTCTTCACAAGTCCGCGTCGT

Paste this into a BLAST search page for me
TCCGCGTCGTTTAGCTTGACTTTTAAACACTTCGATTGTTTCGCGTAGCACGTAGCAATAGTCGCACAATTTTTGGAAGCTTTCAAGGAGTTCCTGGATTAGCACGGAAGATTCTTGCGGACACATTCCTGGATTTTTGGGATATCGGCAGATATCGGCAACGAAGTTTCTGCAGAGAGTCAGCAGTTCGGGTCTCCAGCGGGTCTCCAGCAACGGAGCTTTCAAGAGCTTTCAACTTGCCGCAGAGTTTGTGGATCCAGCCTACGGAGGCAACAGCAACAAATTCGTCTGCCACAAGGGTTTGAGTGCACAGCCATGAGTCTTCATGAGTCTTCACAAGTCCGCGTCGT

Full Affymetrix probeset data:

Annotations for 1630028_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720