Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630030_at:

>probe:Drosophila_2:1630030_at:450:317; Interrogation_Position=1005; Antisense; GCCTGGAGCGAGGAGTCCTTCTACT
>probe:Drosophila_2:1630030_at:404:587; Interrogation_Position=1008; Antisense; TGGAGCGAGGAGTCCTTCTACTGAT
>probe:Drosophila_2:1630030_at:9:123; Interrogation_Position=1011; Antisense; AGCGAGGAGTCCTTCTACTGATCCG
>probe:Drosophila_2:1630030_at:89:437; Interrogation_Position=1014; Antisense; GAGGAGTCCTTCTACTGATCCGTGA
>probe:Drosophila_2:1630030_at:83:551; Interrogation_Position=1016; Antisense; GGAGTCCTTCTACTGATCCGTGATT
>probe:Drosophila_2:1630030_at:122:87; Interrogation_Position=1018; Antisense; AGTCCTTCTACTGATCCGTGATTCC
>probe:Drosophila_2:1630030_at:701:627; Interrogation_Position=1020; Antisense; TCCTTCTACTGATCCGTGATTCCGC
>probe:Drosophila_2:1630030_at:16:181; Interrogation_Position=1091; Antisense; AAACACTCACTCACACTTGCATTAT
>probe:Drosophila_2:1630030_at:623:187; Interrogation_Position=1092; Antisense; AACACTCACTCACACTTGCATTATG
>probe:Drosophila_2:1630030_at:121:145; Interrogation_Position=1095; Antisense; ACTCACTCACACTTGCATTATGCGC
>probe:Drosophila_2:1630030_at:318:259; Interrogation_Position=1098; Antisense; CACTCACACTTGCATTATGCGCAAA
>probe:Drosophila_2:1630030_at:622:257; Interrogation_Position=1104; Antisense; CACTTGCATTATGCGCAAACTGGAG
>probe:Drosophila_2:1630030_at:127:319; Interrogation_Position=969; Antisense; GCCGATGAACGCGAGGTGAGAGTCA
>probe:Drosophila_2:1630030_at:332:513; Interrogation_Position=984; Antisense; GTGAGAGTCAGGTTGATAAGCGCCT

Paste this into a BLAST search page for me
GCCTGGAGCGAGGAGTCCTTCTACTTGGAGCGAGGAGTCCTTCTACTGATAGCGAGGAGTCCTTCTACTGATCCGGAGGAGTCCTTCTACTGATCCGTGAGGAGTCCTTCTACTGATCCGTGATTAGTCCTTCTACTGATCCGTGATTCCTCCTTCTACTGATCCGTGATTCCGCAAACACTCACTCACACTTGCATTATAACACTCACTCACACTTGCATTATGACTCACTCACACTTGCATTATGCGCCACTCACACTTGCATTATGCGCAAACACTTGCATTATGCGCAAACTGGAGGCCGATGAACGCGAGGTGAGAGTCAGTGAGAGTCAGGTTGATAAGCGCCT

Full Affymetrix probeset data:

Annotations for 1630030_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime