FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630031_at:

>probe:Drosophila_2:1630031_at:395:703; Interrogation_Position=301; Antisense; TTATGCCGCCAAGCGTTTCCGCAAG
>probe:Drosophila_2:1630031_at:684:85; Interrogation_Position=330; Antisense; AGTGCCCCATTGTGGAGCGTTTGAC
>probe:Drosophila_2:1630031_at:204:481; Interrogation_Position=348; Antisense; GTTTGACCTGCTCCCTGATGATGAA
>probe:Drosophila_2:1630031_at:189:361; Interrogation_Position=387; Antisense; GCAAGAAGCTGATGGCCTGCCGCAT
>probe:Drosophila_2:1630031_at:372:471; Interrogation_Position=424; Antisense; GTTCGAGATCATTCATCTGCTCACC
>probe:Drosophila_2:1630031_at:289:529; Interrogation_Position=450; Antisense; GGGAGAACCCTCTGCAGATCCTGGT
>probe:Drosophila_2:1630031_at:156:509; Interrogation_Position=501; Antisense; GTGAGGACTCCACCCGTATTGGACG
>probe:Drosophila_2:1630031_at:527:623; Interrogation_Position=567; Antisense; TGCGTCGCGTCAACCAGGCTATCTG
>probe:Drosophila_2:1630031_at:401:71; Interrogation_Position=582; Antisense; AGGCTATCTGGCTGCTGTGCACTGG
>probe:Drosophila_2:1630031_at:163:573; Interrogation_Position=616; Antisense; GGCTGCCTTCAGGAACATCAAGACC
>probe:Drosophila_2:1630031_at:413:213; Interrogation_Position=635; Antisense; AAGACCATCGCCGAGTGCCTGGCTG
>probe:Drosophila_2:1630031_at:638:331; Interrogation_Position=677; Antisense; GCTAAGGGATCTTCCAACTCGTACG
>probe:Drosophila_2:1630031_at:224:517; Interrogation_Position=729; Antisense; GTGTCGCCAAGTCCAACCGTTAAGG
>probe:Drosophila_2:1630031_at:276:291; Interrogation_Position=746; Antisense; CGTTAAGGAGACATCATCACCAGCA

Paste this into a BLAST search page for me
TTATGCCGCCAAGCGTTTCCGCAAGAGTGCCCCATTGTGGAGCGTTTGACGTTTGACCTGCTCCCTGATGATGAAGCAAGAAGCTGATGGCCTGCCGCATGTTCGAGATCATTCATCTGCTCACCGGGAGAACCCTCTGCAGATCCTGGTGTGAGGACTCCACCCGTATTGGACGTGCGTCGCGTCAACCAGGCTATCTGAGGCTATCTGGCTGCTGTGCACTGGGGCTGCCTTCAGGAACATCAAGACCAAGACCATCGCCGAGTGCCTGGCTGGCTAAGGGATCTTCCAACTCGTACGGTGTCGCCAAGTCCAACCGTTAAGGCGTTAAGGAGACATCATCACCAGCA

Full Affymetrix probeset data:

Annotations for 1630031_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720