FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630032_at:

>probe:Drosophila_2:1630032_at:468:185; Interrogation_Position=105; Antisense; AAAATAAGATTCACCCTGCCACGGG
>probe:Drosophila_2:1630032_at:15:607; Interrogation_Position=135; Antisense; TGAGCAACGTGCATCAGTTTGATAC
>probe:Drosophila_2:1630032_at:169:567; Interrogation_Position=169; Antisense; GGCGGAATCGCCTCAAATTAGACGC
>probe:Drosophila_2:1630032_at:400:153; Interrogation_Position=195; Antisense; ACATGGGTCGCCTATGTGCCACGTG
>probe:Drosophila_2:1630032_at:236:259; Interrogation_Position=214; Antisense; CACGTGGCCTTCGAAGGACTCTGAG
>probe:Drosophila_2:1630032_at:456:567; Interrogation_Position=248; Antisense; GGCACAGCTTTGAGGGCAGCCACAC
>probe:Drosophila_2:1630032_at:223:605; Interrogation_Position=306; Antisense; TGAGTGTTACCCTTGCCCCGAAGGA
>probe:Drosophila_2:1630032_at:588:557; Interrogation_Position=328; Antisense; GGACATGCAACGAAACCACCTGCTA
>probe:Drosophila_2:1630032_at:334:107; Interrogation_Position=375; Antisense; AGAAACCAACGATAACAGCCACCAT
>probe:Drosophila_2:1630032_at:563:387; Interrogation_Position=435; Antisense; GAAAATCAGTTACAGCCACACGGAG
>probe:Drosophila_2:1630032_at:461:373; Interrogation_Position=463; Antisense; GAAGTTGAACCCGAACATTCTCCTT
>probe:Drosophila_2:1630032_at:666:235; Interrogation_Position=584; Antisense; AATCCCTGTGTGTTCGGCGTGTGCA
>probe:Drosophila_2:1630032_at:308:575; Interrogation_Position=599; Antisense; GGCGTGTGCATCGATGGCCTAAACA
>probe:Drosophila_2:1630032_at:724:45; Interrogation_Position=656; Antisense; ATCCTTCACACTTTTTAATGCCTGC

Paste this into a BLAST search page for me
AAAATAAGATTCACCCTGCCACGGGTGAGCAACGTGCATCAGTTTGATACGGCGGAATCGCCTCAAATTAGACGCACATGGGTCGCCTATGTGCCACGTGCACGTGGCCTTCGAAGGACTCTGAGGGCACAGCTTTGAGGGCAGCCACACTGAGTGTTACCCTTGCCCCGAAGGAGGACATGCAACGAAACCACCTGCTAAGAAACCAACGATAACAGCCACCATGAAAATCAGTTACAGCCACACGGAGGAAGTTGAACCCGAACATTCTCCTTAATCCCTGTGTGTTCGGCGTGTGCAGGCGTGTGCATCGATGGCCTAAACAATCCTTCACACTTTTTAATGCCTGC

Full Affymetrix probeset data:

Annotations for 1630032_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720