FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630034_at:

>probe:Drosophila_2:1630034_at:165:319; Interrogation_Position=1483; Antisense; GCCGTGACATTACCCAGCTGATGGA
>probe:Drosophila_2:1630034_at:112:159; Interrogation_Position=1507; Antisense; ACAAACTGGGTCTGGGCGACAGTCT
>probe:Drosophila_2:1630034_at:323:251; Interrogation_Position=1637; Antisense; CAAGGCCGCCGAGGCTGACAAGTTG
>probe:Drosophila_2:1630034_at:490:397; Interrogation_Position=1653; Antisense; GACAAGTTGCTCGAGGTCCTGCAGA
>probe:Drosophila_2:1630034_at:498:579; Interrogation_Position=1757; Antisense; GGCCACCGCTGAGTTGGCTTAGATA
>probe:Drosophila_2:1630034_at:416:27; Interrogation_Position=1779; Antisense; ATAGCCGCCGTATACAGTCATCTAT
>probe:Drosophila_2:1630034_at:346:645; Interrogation_Position=1796; Antisense; TCATCTATTTCAGGACTCGAGTAAC
>probe:Drosophila_2:1630034_at:142:197; Interrogation_Position=1818; Antisense; AACTGGCTGAGTGGATTTCTGGGAT
>probe:Drosophila_2:1630034_at:95:531; Interrogation_Position=1838; Antisense; GGGATTTCTCCCAAATGGATGTTGT
>probe:Drosophila_2:1630034_at:196:391; Interrogation_Position=1880; Antisense; GAAACTCAATACTCGACTCCTGAAA
>probe:Drosophila_2:1630034_at:222:3; Interrogation_Position=1905; Antisense; ATCGGACGCGTAGTTCCCCAAACAG
>probe:Drosophila_2:1630034_at:414:281; Interrogation_Position=1943; Antisense; CTCTCCTAGTTCTGTGTTGTGCGTA
>probe:Drosophila_2:1630034_at:193:29; Interrogation_Position=2034; Antisense; ATACTCGACGAGTGCTGCTAATTCC
>probe:Drosophila_2:1630034_at:542:653; Interrogation_Position=2052; Antisense; TAATTCCCAGCGAGAGTGTGCCAAT

Paste this into a BLAST search page for me
GCCGTGACATTACCCAGCTGATGGAACAAACTGGGTCTGGGCGACAGTCTCAAGGCCGCCGAGGCTGACAAGTTGGACAAGTTGCTCGAGGTCCTGCAGAGGCCACCGCTGAGTTGGCTTAGATAATAGCCGCCGTATACAGTCATCTATTCATCTATTTCAGGACTCGAGTAACAACTGGCTGAGTGGATTTCTGGGATGGGATTTCTCCCAAATGGATGTTGTGAAACTCAATACTCGACTCCTGAAAATCGGACGCGTAGTTCCCCAAACAGCTCTCCTAGTTCTGTGTTGTGCGTAATACTCGACGAGTGCTGCTAATTCCTAATTCCCAGCGAGAGTGTGCCAAT

Full Affymetrix probeset data:

Annotations for 1630034_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720