Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630036_at:

>probe:Drosophila_2:1630036_at:496:237; Interrogation_Position=2357; Antisense; TATGGCTAACGGGAAGCCTCCGCTG
>probe:Drosophila_2:1630036_at:457:633; Interrogation_Position=2375; Antisense; TCCGCTGCCATATATCCTGCATAAA
>probe:Drosophila_2:1630036_at:117:29; Interrogation_Position=2399; Antisense; ATACGCAATATGTGGCCTGTGTGTG
>probe:Drosophila_2:1630036_at:394:595; Interrogation_Position=2430; Antisense; TGTGTGTGTCTAGTGGCATTGTGCA
>probe:Drosophila_2:1630036_at:648:325; Interrogation_Position=2469; Antisense; GCGAGCGTGACGAACTGGTCAACAA
>probe:Drosophila_2:1630036_at:205:13; Interrogation_Position=2528; Antisense; ATTCAATCCAATTCCGAAGCAGCGG
>probe:Drosophila_2:1630036_at:307:613; Interrogation_Position=2562; Antisense; TGAAAACCAGAAGTGTTCCGGCGAT
>probe:Drosophila_2:1630036_at:533:603; Interrogation_Position=2575; Antisense; TGTTCCGGCGATGGCGATTATCAGT
>probe:Drosophila_2:1630036_at:150:201; Interrogation_Position=2631; Antisense; AACCCAAAGCGAAGTGTGCCAACCA
>probe:Drosophila_2:1630036_at:216:517; Interrogation_Position=2644; Antisense; GTGTGCCAACCAATCTCATATTCAA
>probe:Drosophila_2:1630036_at:628:11; Interrogation_Position=2711; Antisense; ATTCATTGGGATTATGCAGCTCGTA
>probe:Drosophila_2:1630036_at:696:221; Interrogation_Position=2792; Antisense; AAGGGTCTATGTTGTTAGTGCTTAA
>probe:Drosophila_2:1630036_at:411:705; Interrogation_Position=2830; Antisense; TTAGTGTGATGCTTTTCGTTCGTTC
>probe:Drosophila_2:1630036_at:579:341; Interrogation_Position=2840; Antisense; GCTTTTCGTTCGTTCATTGATTTCA

Paste this into a BLAST search page for me
TATGGCTAACGGGAAGCCTCCGCTGTCCGCTGCCATATATCCTGCATAAAATACGCAATATGTGGCCTGTGTGTGTGTGTGTGTCTAGTGGCATTGTGCAGCGAGCGTGACGAACTGGTCAACAAATTCAATCCAATTCCGAAGCAGCGGTGAAAACCAGAAGTGTTCCGGCGATTGTTCCGGCGATGGCGATTATCAGTAACCCAAAGCGAAGTGTGCCAACCAGTGTGCCAACCAATCTCATATTCAAATTCATTGGGATTATGCAGCTCGTAAAGGGTCTATGTTGTTAGTGCTTAATTAGTGTGATGCTTTTCGTTCGTTCGCTTTTCGTTCGTTCATTGATTTCA

Full Affymetrix probeset data:

Annotations for 1630036_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime