FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630037_at:

>probe:Drosophila_2:1630037_at:697:615; Interrogation_Position=1067; Antisense; TGCACCATGTTCAGCAGCCCATAAT
>probe:Drosophila_2:1630037_at:632:123; Interrogation_Position=1082; Antisense; AGCCCATAATCTTCATTGCCGGAGG
>probe:Drosophila_2:1630037_at:462:37; Interrogation_Position=1108; Antisense; ATCTTTCCCATCTCTATGAACAGCA
>probe:Drosophila_2:1630037_at:417:471; Interrogation_Position=1149; Antisense; GTTCGCCTTCAGCATCATTACAATA
>probe:Drosophila_2:1630037_at:577:683; Interrogation_Position=634; Antisense; TATCCCCTGATGTTCACCATTATGT
>probe:Drosophila_2:1630037_at:694:77; Interrogation_Position=674; Antisense; AGGTCCTCAAGGATCACGTGCGGAG
>probe:Drosophila_2:1630037_at:19:451; Interrogation_Position=709; Antisense; GATCCCGAGCGCAGTGAGGCAGACA
>probe:Drosophila_2:1630037_at:61:511; Interrogation_Position=748; Antisense; GTGAACTGCGTGCTGGACCACAAGA
>probe:Drosophila_2:1630037_at:273:167; Interrogation_Position=781; Antisense; AAATGCTGTGACATGATTCGCCCCA
>probe:Drosophila_2:1630037_at:261:247; Interrogation_Position=830; Antisense; AATTCGCGCTGATTGGTTCCGTTTT
>probe:Drosophila_2:1630037_at:605:471; Interrogation_Position=876; Antisense; GTTCTTCTTCTCGAACTTCTGGAAG
>probe:Drosophila_2:1630037_at:259:157; Interrogation_Position=959; Antisense; ACACCTGCAACATGCTGATCGACGA
>probe:Drosophila_2:1630037_at:286:447; Interrogation_Position=982; Antisense; GATGCCCAGGATCTGTCCAACGAGA
>probe:Drosophila_2:1630037_at:59:505; Interrogation_Position=996; Antisense; GTCCAACGAGATTTTCCAGTCCAAC

Paste this into a BLAST search page for me
TGCACCATGTTCAGCAGCCCATAATAGCCCATAATCTTCATTGCCGGAGGATCTTTCCCATCTCTATGAACAGCAGTTCGCCTTCAGCATCATTACAATATATCCCCTGATGTTCACCATTATGTAGGTCCTCAAGGATCACGTGCGGAGGATCCCGAGCGCAGTGAGGCAGACAGTGAACTGCGTGCTGGACCACAAGAAAATGCTGTGACATGATTCGCCCCAAATTCGCGCTGATTGGTTCCGTTTTGTTCTTCTTCTCGAACTTCTGGAAGACACCTGCAACATGCTGATCGACGAGATGCCCAGGATCTGTCCAACGAGAGTCCAACGAGATTTTCCAGTCCAAC

Full Affymetrix probeset data:

Annotations for 1630037_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720