FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630039_at:

>probe:Drosophila_2:1630039_at:609:283; Interrogation_Position=3805; Antisense; CTGAAACGCGGCCACTTGGGAAATA
>probe:Drosophila_2:1630039_at:717:171; Interrogation_Position=3845; Antisense; AAAGATGCCAGGTAACCGCAGCCAC
>probe:Drosophila_2:1630039_at:612:189; Interrogation_Position=3909; Antisense; AACATCTCGCAATGCCAAGGCAGCA
>probe:Drosophila_2:1630039_at:474:315; Interrogation_Position=3952; Antisense; GCCATTACAGGGTCAAGCAGCAATT
>probe:Drosophila_2:1630039_at:312:89; Interrogation_Position=3994; Antisense; AGTAATGCCAGGGATCTGTCGCAGG
>probe:Drosophila_2:1630039_at:17:133; Interrogation_Position=4045; Antisense; ACCGCCCAGTCGCAACAGATTTACG
>probe:Drosophila_2:1630039_at:114:91; Interrogation_Position=4061; Antisense; AGATTTACGTGGAGCGACCACCGTC
>probe:Drosophila_2:1630039_at:113:345; Interrogation_Position=4087; Antisense; GCATTCAGTGGCCTGGTCGACTATA
>probe:Drosophila_2:1630039_at:667:403; Interrogation_Position=4105; Antisense; GACTATAGTGGCTATTCGCCGCACA
>probe:Drosophila_2:1630039_at:382:471; Interrogation_Position=4145; Antisense; GTTCGCTCAGCCAACAGAGTTTCAG
>probe:Drosophila_2:1630039_at:716:427; Interrogation_Position=4161; Antisense; GAGTTTCAGTCCAACGCAGCAATTA
>probe:Drosophila_2:1630039_at:597:13; Interrogation_Position=4182; Antisense; ATTAGCGCCCCACGAAATGCTGCAG
>probe:Drosophila_2:1630039_at:87:321; Interrogation_Position=4207; Antisense; GCCGCCCAGCGTTACGGAACTTTGA
>probe:Drosophila_2:1630039_at:200:379; Interrogation_Position=4290; Antisense; GAAGCCACCTCAGCAAATGGCGGAT

Paste this into a BLAST search page for me
CTGAAACGCGGCCACTTGGGAAATAAAAGATGCCAGGTAACCGCAGCCACAACATCTCGCAATGCCAAGGCAGCAGCCATTACAGGGTCAAGCAGCAATTAGTAATGCCAGGGATCTGTCGCAGGACCGCCCAGTCGCAACAGATTTACGAGATTTACGTGGAGCGACCACCGTCGCATTCAGTGGCCTGGTCGACTATAGACTATAGTGGCTATTCGCCGCACAGTTCGCTCAGCCAACAGAGTTTCAGGAGTTTCAGTCCAACGCAGCAATTAATTAGCGCCCCACGAAATGCTGCAGGCCGCCCAGCGTTACGGAACTTTGAGAAGCCACCTCAGCAAATGGCGGAT

Full Affymetrix probeset data:

Annotations for 1630039_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720