FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630041_at:

>probe:Drosophila_2:1630041_at:445:379; Interrogation_Position=530; Antisense; GAACCTTGAGGTAGGAAGTGCCTCT
>probe:Drosophila_2:1630041_at:725:407; Interrogation_Position=537; Antisense; GAGGTAGGAAGTGCCTCTACGCTTT
>probe:Drosophila_2:1630041_at:510:537; Interrogation_Position=539; Antisense; GGTAGGAAGTGCCTCTACGCTTTAC
>probe:Drosophila_2:1630041_at:204:677; Interrogation_Position=541; Antisense; TAGGAAGTGCCTCTACGCTTTACCT
>probe:Drosophila_2:1630041_at:274:373; Interrogation_Position=544; Antisense; GAAGTGCCTCTACGCTTTACCTATA
>probe:Drosophila_2:1630041_at:90:83; Interrogation_Position=546; Antisense; AGTGCCTCTACGCTTTACCTATACT
>probe:Drosophila_2:1630041_at:518:669; Interrogation_Position=554; Antisense; TACGCTTTACCTATACTCTAGCCAT
>probe:Drosophila_2:1630041_at:461:271; Interrogation_Position=558; Antisense; CTTTACCTATACTCTAGCCATCTTA
>probe:Drosophila_2:1630041_at:77:131; Interrogation_Position=562; Antisense; ACCTATACTCTAGCCATCTTATTTC
>probe:Drosophila_2:1630041_at:383:29; Interrogation_Position=566; Antisense; ATACTCTAGCCATCTTATTTCCATT
>probe:Drosophila_2:1630041_at:714:145; Interrogation_Position=568; Antisense; ACTCTAGCCATCTTATTTCCATTGA
>probe:Drosophila_2:1630041_at:97:675; Interrogation_Position=572; Antisense; TAGCCATCTTATTTCCATTGAAGGA
>probe:Drosophila_2:1630041_at:103:37; Interrogation_Position=577; Antisense; ATCTTATTTCCATTGAAGGATCCGA
>probe:Drosophila_2:1630041_at:531:693; Interrogation_Position=583; Antisense; TTTCCATTGAAGGATCCGAACATCG

Paste this into a BLAST search page for me
GAACCTTGAGGTAGGAAGTGCCTCTGAGGTAGGAAGTGCCTCTACGCTTTGGTAGGAAGTGCCTCTACGCTTTACTAGGAAGTGCCTCTACGCTTTACCTGAAGTGCCTCTACGCTTTACCTATAAGTGCCTCTACGCTTTACCTATACTTACGCTTTACCTATACTCTAGCCATCTTTACCTATACTCTAGCCATCTTAACCTATACTCTAGCCATCTTATTTCATACTCTAGCCATCTTATTTCCATTACTCTAGCCATCTTATTTCCATTGATAGCCATCTTATTTCCATTGAAGGAATCTTATTTCCATTGAAGGATCCGATTTCCATTGAAGGATCCGAACATCG

Full Affymetrix probeset data:

Annotations for 1630041_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720