Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630045_at:

>probe:Drosophila_2:1630045_at:425:349; Interrogation_Position=1074; Antisense; GCACGAGAAGTTTTACGATCCGCAT
>probe:Drosophila_2:1630045_at:317:137; Interrogation_Position=1088; Antisense; ACGATCCGCATTCTGAGTTTTTCTT
>probe:Drosophila_2:1630045_at:376:697; Interrogation_Position=1107; Antisense; TTTCTTTGCCAACATTTTCCACATC
>probe:Drosophila_2:1630045_at:634:701; Interrogation_Position=1121; Antisense; TTTTCCACATCTGCGAAGAGTCCTG
>probe:Drosophila_2:1630045_at:93:175; Interrogation_Position=1154; Antisense; AAAGCGCGTCAAGCGATTCTGGTGC
>probe:Drosophila_2:1630045_at:545:715; Interrogation_Position=1188; Antisense; TTCTGAGAGCTCTTCCAATTCGGAT
>probe:Drosophila_2:1630045_at:651:245; Interrogation_Position=1204; Antisense; AATTCGGATTATCCCATGGCATCCA
>probe:Drosophila_2:1630045_at:186:27; Interrogation_Position=1253; Antisense; ATAGCAAATCCAATCAGCCCATAAC
>probe:Drosophila_2:1630045_at:15:225; Interrogation_Position=1294; Antisense; AAGGATCCCAATTTTCTACTGGACA
>probe:Drosophila_2:1630045_at:702:425; Interrogation_Position=1338; Antisense; GAGTCCCAACAACAGCTTTTACCAG
>probe:Drosophila_2:1630045_at:662:283; Interrogation_Position=1368; Antisense; CTGCGGAAACTCCAGCATTTATGCT
>probe:Drosophila_2:1630045_at:141:401; Interrogation_Position=1444; Antisense; GACATTTGACAAACATCTCCCCGAG
>probe:Drosophila_2:1630045_at:112:543; Interrogation_Position=1491; Antisense; GGATTCGAGCGCATACAATTTCAAT
>probe:Drosophila_2:1630045_at:465:663; Interrogation_Position=1551; Antisense; TAAATACTCACACCTGCCGAACTAG

Paste this into a BLAST search page for me
GCACGAGAAGTTTTACGATCCGCATACGATCCGCATTCTGAGTTTTTCTTTTTCTTTGCCAACATTTTCCACATCTTTTCCACATCTGCGAAGAGTCCTGAAAGCGCGTCAAGCGATTCTGGTGCTTCTGAGAGCTCTTCCAATTCGGATAATTCGGATTATCCCATGGCATCCAATAGCAAATCCAATCAGCCCATAACAAGGATCCCAATTTTCTACTGGACAGAGTCCCAACAACAGCTTTTACCAGCTGCGGAAACTCCAGCATTTATGCTGACATTTGACAAACATCTCCCCGAGGGATTCGAGCGCATACAATTTCAATTAAATACTCACACCTGCCGAACTAG

Full Affymetrix probeset data:

Annotations for 1630045_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime