Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630047_at:

>probe:Drosophila_2:1630047_at:469:581; Interrogation_Position=2179; Antisense; TGGTTGGGTCTTGTATACGGCTTCA
>probe:Drosophila_2:1630047_at:249:339; Interrogation_Position=2208; Antisense; GCTAATCCTGGTGTTTGGCCTCTTT
>probe:Drosophila_2:1630047_at:26:723; Interrogation_Position=2222; Antisense; TTGGCCTCTTTTTGGCGTACGAGAC
>probe:Drosophila_2:1630047_at:162:295; Interrogation_Position=2241; Antisense; CGAGACGCGCTCCATTAAAGTGAAA
>probe:Drosophila_2:1630047_at:234:199; Interrogation_Position=2272; Antisense; AACGATTCGCGTTATGTGGGCATGA
>probe:Drosophila_2:1630047_at:414:57; Interrogation_Position=2293; Antisense; ATGAGCATCTATAACGTGGTCGTCC
>probe:Drosophila_2:1630047_at:406:517; Interrogation_Position=2308; Antisense; GTGGTCGTCCTTTGCCTGATAACAG
>probe:Drosophila_2:1630047_at:474:305; Interrogation_Position=2322; Antisense; CCTGATAACAGCTCCGGTGGGCATG
>probe:Drosophila_2:1630047_at:18:519; Interrogation_Position=2338; Antisense; GTGGGCATGGTCATTGCATCGCAAC
>probe:Drosophila_2:1630047_at:544:469; Interrogation_Position=2383; Antisense; GTTGCTCTAGCTGTGATATTCTGTT
>probe:Drosophila_2:1630047_at:235:715; Interrogation_Position=2401; Antisense; TTCTGTTGTTTCCTAAGCATGCTGC
>probe:Drosophila_2:1630047_at:632:433; Interrogation_Position=2449; Antisense; GAGGTTATACGTCATCCCAAGGATA
>probe:Drosophila_2:1630047_at:651:171; Interrogation_Position=2589; Antisense; AAAGATTCGAGTCCTGCGACAGCGT
>probe:Drosophila_2:1630047_at:109:371; Interrogation_Position=2649; Antisense; GAATGGTGCAACAGGTGTCGCCTCC

Paste this into a BLAST search page for me
TGGTTGGGTCTTGTATACGGCTTCAGCTAATCCTGGTGTTTGGCCTCTTTTTGGCCTCTTTTTGGCGTACGAGACCGAGACGCGCTCCATTAAAGTGAAAAACGATTCGCGTTATGTGGGCATGAATGAGCATCTATAACGTGGTCGTCCGTGGTCGTCCTTTGCCTGATAACAGCCTGATAACAGCTCCGGTGGGCATGGTGGGCATGGTCATTGCATCGCAACGTTGCTCTAGCTGTGATATTCTGTTTTCTGTTGTTTCCTAAGCATGCTGCGAGGTTATACGTCATCCCAAGGATAAAAGATTCGAGTCCTGCGACAGCGTGAATGGTGCAACAGGTGTCGCCTCC

Full Affymetrix probeset data:

Annotations for 1630047_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime