Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630048_at:

>probe:Drosophila_2:1630048_at:153:259; Interrogation_Position=1971; Antisense; CACAGTCAGTGTTTAGTTCATAGCA
>probe:Drosophila_2:1630048_at:95:199; Interrogation_Position=2026; Antisense; AACGATATTTCGCACTCACAATGAA
>probe:Drosophila_2:1630048_at:464:149; Interrogation_Position=2051; Antisense; ACATTCCGAAAGTCTGTAGTACTGA
>probe:Drosophila_2:1630048_at:97:485; Interrogation_Position=2066; Antisense; GTAGTACTGAGTTTCCAGTTTGCCA
>probe:Drosophila_2:1630048_at:269:513; Interrogation_Position=2124; Antisense; GTGATTAGCACACGGTCAAAGCAAT
>probe:Drosophila_2:1630048_at:643:245; Interrogation_Position=2160; Antisense; AATTAATTGATTGCAACGCTCTGGC
>probe:Drosophila_2:1630048_at:100:361; Interrogation_Position=2172; Antisense; GCAACGCTCTGGCAAAACACTGAAA
>probe:Drosophila_2:1630048_at:447:597; Interrogation_Position=2249; Antisense; TGTGCTCCCAATGGAATTCATGTGT
>probe:Drosophila_2:1630048_at:109:645; Interrogation_Position=2266; Antisense; TCATGTGTGGTTTTTTATTCTACCC
>probe:Drosophila_2:1630048_at:288:11; Interrogation_Position=2282; Antisense; ATTCTACCCCTTTTAGCCATAGATG
>probe:Drosophila_2:1630048_at:285:441; Interrogation_Position=2303; Antisense; GATGTCATAGATTTCGAGACCCCGA
>probe:Drosophila_2:1630048_at:448:471; Interrogation_Position=2353; Antisense; GTTCGCACCAAATGTCAGATCTAAT
>probe:Drosophila_2:1630048_at:356:453; Interrogation_Position=2370; Antisense; GATCTAATGGATTTTGTCACTGGCC
>probe:Drosophila_2:1630048_at:466:493; Interrogation_Position=2385; Antisense; GTCACTGGCCACAAATCATGCAAGA

Paste this into a BLAST search page for me
CACAGTCAGTGTTTAGTTCATAGCAAACGATATTTCGCACTCACAATGAAACATTCCGAAAGTCTGTAGTACTGAGTAGTACTGAGTTTCCAGTTTGCCAGTGATTAGCACACGGTCAAAGCAATAATTAATTGATTGCAACGCTCTGGCGCAACGCTCTGGCAAAACACTGAAATGTGCTCCCAATGGAATTCATGTGTTCATGTGTGGTTTTTTATTCTACCCATTCTACCCCTTTTAGCCATAGATGGATGTCATAGATTTCGAGACCCCGAGTTCGCACCAAATGTCAGATCTAATGATCTAATGGATTTTGTCACTGGCCGTCACTGGCCACAAATCATGCAAGA

Full Affymetrix probeset data:

Annotations for 1630048_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime