FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630049_at:

>probe:Drosophila_2:1630049_at:715:93; Interrogation_Position=267; Antisense; AGTTGATCCAATCGACGCCGTATGA
>probe:Drosophila_2:1630049_at:473:397; Interrogation_Position=314; Antisense; GACAACTACTATTCCGGTGAGCGTG
>probe:Drosophila_2:1630049_at:265:63; Interrogation_Position=375; Antisense; ATGTGCGACAATTTCATCCCCACGA
>probe:Drosophila_2:1630049_at:14:405; Interrogation_Position=422; Antisense; GACTATGTCATCGTCCAGGGAAATC
>probe:Drosophila_2:1630049_at:726:81; Interrogation_Position=438; Antisense; AGGGAAATCACAATCGTCGCGACGA
>probe:Drosophila_2:1630049_at:392:501; Interrogation_Position=453; Antisense; GTCGCGACGAGGGTTCCAATGGCCT
>probe:Drosophila_2:1630049_at:604:725; Interrogation_Position=492; Antisense; TTGTGAGGAAGTACCTTCTGCCCCG
>probe:Drosophila_2:1630049_at:599:625; Interrogation_Position=510; Antisense; TGCCCCGCGGATACAATGCCAATGA
>probe:Drosophila_2:1630049_at:193:539; Interrogation_Position=535; Antisense; GGTAATCTCGGACATATCCAGCGAT
>probe:Drosophila_2:1630049_at:114:93; Interrogation_Position=620; Antisense; AGATTGGTCCGCGTTCATGAAACCG
>probe:Drosophila_2:1630049_at:234:53; Interrogation_Position=636; Antisense; ATGAAACCGGAAAGCTGGCCCTGCC
>probe:Drosophila_2:1630049_at:464:581; Interrogation_Position=651; Antisense; TGGCCCTGCCCTGGAAATAGTGGAC
>probe:Drosophila_2:1630049_at:359:369; Interrogation_Position=741; Antisense; GAATGCGCCTAACTCAAGGTGAACT
>probe:Drosophila_2:1630049_at:398:383; Interrogation_Position=761; Antisense; GAACTATTTTCGGACACCAAGCAAT

Paste this into a BLAST search page for me
AGTTGATCCAATCGACGCCGTATGAGACAACTACTATTCCGGTGAGCGTGATGTGCGACAATTTCATCCCCACGAGACTATGTCATCGTCCAGGGAAATCAGGGAAATCACAATCGTCGCGACGAGTCGCGACGAGGGTTCCAATGGCCTTTGTGAGGAAGTACCTTCTGCCCCGTGCCCCGCGGATACAATGCCAATGAGGTAATCTCGGACATATCCAGCGATAGATTGGTCCGCGTTCATGAAACCGATGAAACCGGAAAGCTGGCCCTGCCTGGCCCTGCCCTGGAAATAGTGGACGAATGCGCCTAACTCAAGGTGAACTGAACTATTTTCGGACACCAAGCAAT

Full Affymetrix probeset data:

Annotations for 1630049_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720