FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630050_at:

>probe:Drosophila_2:1630050_at:67:65; Interrogation_Position=1800; Antisense; ATGGTGCTACCATTGCCTGGATGAG
>probe:Drosophila_2:1630050_at:718:443; Interrogation_Position=1819; Antisense; GATGAGGCCGTTTTTAACTGCTGCT
>probe:Drosophila_2:1630050_at:464:709; Interrogation_Position=1832; Antisense; TTAACTGCTGCTTTACTGCGTCCTA
>probe:Drosophila_2:1630050_at:2:671; Interrogation_Position=1855; Antisense; TACTGCAGCGTTGAATGCCAGCGAC
>probe:Drosophila_2:1630050_at:125:33; Interrogation_Position=1883; Antisense; ATAAGAGACGCCACCAAGCATCCTG
>probe:Drosophila_2:1630050_at:175:209; Interrogation_Position=1898; Antisense; AAGCATCCTGCAAAGTTACTCATTA
>probe:Drosophila_2:1630050_at:402:37; Interrogation_Position=1969; Antisense; ATCTCGTTTGTTACCATCCTTTTGT
>probe:Drosophila_2:1630050_at:636:599; Interrogation_Position=1991; Antisense; TGTATCAAATGTATCCGTTCTTAAG
>probe:Drosophila_2:1630050_at:246:613; Interrogation_Position=2089; Antisense; TGAAAATGGCGCCTTTTCCGTTCTT
>probe:Drosophila_2:1630050_at:230:695; Interrogation_Position=2103; Antisense; TTTCCGTTCTTATGATGGGCAGCAC
>probe:Drosophila_2:1630050_at:130:595; Interrogation_Position=2118; Antisense; TGGGCAGCACTGTTTCCGCTAGGTG
>probe:Drosophila_2:1630050_at:545:533; Interrogation_Position=2139; Antisense; GGTGTCGCCACCTGATCATATTAAT
>probe:Drosophila_2:1630050_at:586:507; Interrogation_Position=2220; Antisense; GTGGGCGTGGAACTTACTTGTACTT
>probe:Drosophila_2:1630050_at:366:531; Interrogation_Position=2305; Antisense; GGGTATTATTTCGTGCCAGCTGTAT

Paste this into a BLAST search page for me
ATGGTGCTACCATTGCCTGGATGAGGATGAGGCCGTTTTTAACTGCTGCTTTAACTGCTGCTTTACTGCGTCCTATACTGCAGCGTTGAATGCCAGCGACATAAGAGACGCCACCAAGCATCCTGAAGCATCCTGCAAAGTTACTCATTAATCTCGTTTGTTACCATCCTTTTGTTGTATCAAATGTATCCGTTCTTAAGTGAAAATGGCGCCTTTTCCGTTCTTTTTCCGTTCTTATGATGGGCAGCACTGGGCAGCACTGTTTCCGCTAGGTGGGTGTCGCCACCTGATCATATTAATGTGGGCGTGGAACTTACTTGTACTTGGGTATTATTTCGTGCCAGCTGTAT

Full Affymetrix probeset data:

Annotations for 1630050_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720