FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630051_at:

>probe:Drosophila_2:1630051_at:6:671; Interrogation_Position=435; Antisense; TACGTGCTGGGTGTTCGTGAACCGA
>probe:Drosophila_2:1630051_at:93:717; Interrogation_Position=466; Antisense; TTCCTGGGCGATATGTCCAATCTGG
>probe:Drosophila_2:1630051_at:79:237; Interrogation_Position=484; Antisense; AATCTGGTTAACTTGCTCTGGGACT
>probe:Drosophila_2:1630051_at:119:283; Interrogation_Position=521; Antisense; CTGCCATGGGCGTTCTTGAGGAAAC
>probe:Drosophila_2:1630051_at:614:639; Interrogation_Position=548; Antisense; TCGGCTGCTGCGGTGATACGAGCTA
>probe:Drosophila_2:1630051_at:646:513; Interrogation_Position=560; Antisense; GTGATACGAGCTATACCAACTACAA
>probe:Drosophila_2:1630051_at:588:615; Interrogation_Position=679; Antisense; TGCAGCGCCAAGTTCGAGGAGTTCT
>probe:Drosophila_2:1630051_at:487:397; Interrogation_Position=709; Antisense; GACAACATGGACATCATCCGCTGGT
>probe:Drosophila_2:1630051_at:424:127; Interrogation_Position=805; Antisense; AGCCAGAACGCAGGTCGCCAGGTGT
>probe:Drosophila_2:1630051_at:503:633; Interrogation_Position=819; Antisense; TCGCCAGGTGTACGCCTAAACTTGT
>probe:Drosophila_2:1630051_at:488:579; Interrogation_Position=859; Antisense; GGCCAAAGGATCTACATATGTCTAC
>probe:Drosophila_2:1630051_at:60:159; Interrogation_Position=899; Antisense; ACAAACTGTTTTTCGAGCCGTGCCA
>probe:Drosophila_2:1630051_at:485:669; Interrogation_Position=935; Antisense; TACGTCTACATTTCGCCTATTTATC
>probe:Drosophila_2:1630051_at:247:477; Interrogation_Position=973; Antisense; GTTATTCTTTATACTCTTTTTGGAG

Paste this into a BLAST search page for me
TACGTGCTGGGTGTTCGTGAACCGATTCCTGGGCGATATGTCCAATCTGGAATCTGGTTAACTTGCTCTGGGACTCTGCCATGGGCGTTCTTGAGGAAACTCGGCTGCTGCGGTGATACGAGCTAGTGATACGAGCTATACCAACTACAATGCAGCGCCAAGTTCGAGGAGTTCTGACAACATGGACATCATCCGCTGGTAGCCAGAACGCAGGTCGCCAGGTGTTCGCCAGGTGTACGCCTAAACTTGTGGCCAAAGGATCTACATATGTCTACACAAACTGTTTTTCGAGCCGTGCCATACGTCTACATTTCGCCTATTTATCGTTATTCTTTATACTCTTTTTGGAG

Full Affymetrix probeset data:

Annotations for 1630051_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720