FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630054_at:

>probe:Drosophila_2:1630054_at:206:665; Interrogation_Position=1346; Antisense; TACACCTGACCTTCAACCTGAGTGA
>probe:Drosophila_2:1630054_at:707:41; Interrogation_Position=1402; Antisense; ATCGTGGTCGGTTGCATCGGTAGCA
>probe:Drosophila_2:1630054_at:544:41; Interrogation_Position=1417; Antisense; ATCGGTAGCATCTGTTGGTTCCTGG
>probe:Drosophila_2:1630054_at:541:23; Interrogation_Position=1451; Antisense; ATATGCCCGAGGTGTATGGACTGAC
>probe:Drosophila_2:1630054_at:465:679; Interrogation_Position=1465; Antisense; TATGGACTGACGCTGGGCTTGCTAA
>probe:Drosophila_2:1630054_at:555:593; Interrogation_Position=1478; Antisense; TGGGCTTGCTAATGGCATCACTTCC
>probe:Drosophila_2:1630054_at:273:57; Interrogation_Position=1531; Antisense; ATGATTTTGGCCTGCCTGGGCGAAC
>probe:Drosophila_2:1630054_at:699:249; Interrogation_Position=1562; Antisense; CAATGGAGCAGCGTAGTTGCCTCTC
>probe:Drosophila_2:1630054_at:260:357; Interrogation_Position=1712; Antisense; GCACATGTTGCCTGGTCACGCGGGA
>probe:Drosophila_2:1630054_at:402:495; Interrogation_Position=1726; Antisense; GTCACGCGGGACAAGGAGCAGCCAC
>probe:Drosophila_2:1630054_at:500:259; Interrogation_Position=1748; Antisense; CACCGGTCGGAGCTGTGGTAAACAA
>probe:Drosophila_2:1630054_at:632:399; Interrogation_Position=1775; Antisense; GACAGCAACTTATTGCGTTCACGTA
>probe:Drosophila_2:1630054_at:620:679; Interrogation_Position=1847; Antisense; TAGTGTGTGTCAAGTATTCGCGAAC
>probe:Drosophila_2:1630054_at:257:339; Interrogation_Position=1886; Antisense; GCTCATTAAACATTCGCTTATCGCG

Paste this into a BLAST search page for me
TACACCTGACCTTCAACCTGAGTGAATCGTGGTCGGTTGCATCGGTAGCAATCGGTAGCATCTGTTGGTTCCTGGATATGCCCGAGGTGTATGGACTGACTATGGACTGACGCTGGGCTTGCTAATGGGCTTGCTAATGGCATCACTTCCATGATTTTGGCCTGCCTGGGCGAACCAATGGAGCAGCGTAGTTGCCTCTCGCACATGTTGCCTGGTCACGCGGGAGTCACGCGGGACAAGGAGCAGCCACCACCGGTCGGAGCTGTGGTAAACAAGACAGCAACTTATTGCGTTCACGTATAGTGTGTGTCAAGTATTCGCGAACGCTCATTAAACATTCGCTTATCGCG

Full Affymetrix probeset data:

Annotations for 1630054_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720