FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630056_at:

>probe:Drosophila_2:1630056_at:667:601; Interrogation_Position=1192; Antisense; TGTTTATTCATTTGCCAGTCCGTAT
>probe:Drosophila_2:1630056_at:270:23; Interrogation_Position=1219; Antisense; ATATGTATCGCCTTCGGTGGGTTGG
>probe:Drosophila_2:1630056_at:251:693; Interrogation_Position=1260; Antisense; TTTGCCGCTGGATGGGAAACTTTAT
>probe:Drosophila_2:1630056_at:391:27; Interrogation_Position=1283; Antisense; ATAGCCACGTTCTGCATGGAATCCT
>probe:Drosophila_2:1630056_at:200:367; Interrogation_Position=1301; Antisense; GAATCCTGTGGTCGCAAGAAGCCCA
>probe:Drosophila_2:1630056_at:109:157; Interrogation_Position=1325; Antisense; ACACTTCTAGGACTCATCGTTTGCA
>probe:Drosophila_2:1630056_at:336:267; Interrogation_Position=1348; Antisense; CAGTGTCATGTCCTTTGTGGTGGCA
>probe:Drosophila_2:1630056_at:568:521; Interrogation_Position=1367; Antisense; GTGGCAGGCCAGTTCAATATCTTTA
>probe:Drosophila_2:1630056_at:528:537; Interrogation_Position=1423; Antisense; GGTCTTTGAACTGTTTGCCGGTATC
>probe:Drosophila_2:1630056_at:397:447; Interrogation_Position=1534; Antisense; GATGCTGGTATTCTTGGTGTTGACT
>probe:Drosophila_2:1630056_at:620:99; Interrogation_Position=1565; Antisense; AGATGGAGCTCTTCTGGCGGAGCCA
>probe:Drosophila_2:1630056_at:604:63; Interrogation_Position=1604; Antisense; ATGGGAGGACTCTATCTCTTTGGCT
>probe:Drosophila_2:1630056_at:443:621; Interrogation_Position=1650; Antisense; TGCCGGAAACCAGAAGGACCACTTT
>probe:Drosophila_2:1630056_at:627:641; Interrogation_Position=1737; Antisense; TCTTTTACCGCTTTAGTCATTCCAA

Paste this into a BLAST search page for me
TGTTTATTCATTTGCCAGTCCGTATATATGTATCGCCTTCGGTGGGTTGGTTTGCCGCTGGATGGGAAACTTTATATAGCCACGTTCTGCATGGAATCCTGAATCCTGTGGTCGCAAGAAGCCCAACACTTCTAGGACTCATCGTTTGCACAGTGTCATGTCCTTTGTGGTGGCAGTGGCAGGCCAGTTCAATATCTTTAGGTCTTTGAACTGTTTGCCGGTATCGATGCTGGTATTCTTGGTGTTGACTAGATGGAGCTCTTCTGGCGGAGCCAATGGGAGGACTCTATCTCTTTGGCTTGCCGGAAACCAGAAGGACCACTTTTCTTTTACCGCTTTAGTCATTCCAA

Full Affymetrix probeset data:

Annotations for 1630056_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720