FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630057_at:

>probe:Drosophila_2:1630057_at:318:53; Interrogation_Position=118; Antisense; ATGAAGGGCGGCACCTTTCGCAACA
>probe:Drosophila_2:1630057_at:11:281; Interrogation_Position=168; Antisense; CTCACAGATTGTGTCCATGCAGTTC
>probe:Drosophila_2:1630057_at:293:583; Interrogation_Position=215; Antisense; TACTCGTCTTCGTGGCCAACAAGTT
>probe:Drosophila_2:1630057_at:144:89; Interrogation_Position=256; Antisense; AGTCTGGATCACTTGTTCGAATACC
>probe:Drosophila_2:1630057_at:64:593; Interrogation_Position=314; Antisense; TGGTGATCTGCGCATTTGTTTTAAA
>probe:Drosophila_2:1630057_at:157:701; Interrogation_Position=332; Antisense; TTTTAAATGCGTTCTTAGCCTCCCT
>probe:Drosophila_2:1630057_at:602:101; Interrogation_Position=379; Antisense; AGAGCCAAGCTCTGTCTGGACTTTA
>probe:Drosophila_2:1630057_at:582:583; Interrogation_Position=395; Antisense; TGGACTTTAGTTGCACCTTCCACGT
>probe:Drosophila_2:1630057_at:367:273; Interrogation_Position=424; Antisense; CATTTGCTGATCTGCTGGTGGTACA
>probe:Drosophila_2:1630057_at:670:381; Interrogation_Position=465; Antisense; GAACGCATCGTGGTGGCTACTGAAT
>probe:Drosophila_2:1630057_at:237:571; Interrogation_Position=479; Antisense; GGCTACTGAATGTCATCACCGGCAC
>probe:Drosophila_2:1630057_at:248:607; Interrogation_Position=570; Antisense; TGCGGCCCTCAATCAAAAGTCGGAC
>probe:Drosophila_2:1630057_at:200:219; Interrogation_Position=586; Antisense; AAGTCGGACGTCTGACTCGAAGCCA
>probe:Drosophila_2:1630057_at:376:379; Interrogation_Position=604; Antisense; GAAGCCACCAACTTGTGATGCCTGC

Paste this into a BLAST search page for me
ATGAAGGGCGGCACCTTTCGCAACACTCACAGATTGTGTCCATGCAGTTCTACTCGTCTTCGTGGCCAACAAGTTAGTCTGGATCACTTGTTCGAATACCTGGTGATCTGCGCATTTGTTTTAAATTTTAAATGCGTTCTTAGCCTCCCTAGAGCCAAGCTCTGTCTGGACTTTATGGACTTTAGTTGCACCTTCCACGTCATTTGCTGATCTGCTGGTGGTACAGAACGCATCGTGGTGGCTACTGAATGGCTACTGAATGTCATCACCGGCACTGCGGCCCTCAATCAAAAGTCGGACAAGTCGGACGTCTGACTCGAAGCCAGAAGCCACCAACTTGTGATGCCTGC

Full Affymetrix probeset data:

Annotations for 1630057_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720