FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630059_at:

>probe:Drosophila_2:1630059_at:291:397; Interrogation_Position=348; Antisense; GACAATTGCAATGTTTCTTAGCATT
>probe:Drosophila_2:1630059_at:506:645; Interrogation_Position=363; Antisense; TCTTAGCATTATTATCGGAAACTCG
>probe:Drosophila_2:1630059_at:571:1; Interrogation_Position=373; Antisense; ATTATCGGAAACTCGTGCAAAAAGT
>probe:Drosophila_2:1630059_at:475:507; Interrogation_Position=387; Antisense; GTGCAAAAAGTATACACCTGCGTGT
>probe:Drosophila_2:1630059_at:347:131; Interrogation_Position=402; Antisense; ACCTGCGTGTGGGATCGAAACCTTT
>probe:Drosophila_2:1630059_at:211:391; Interrogation_Position=418; Antisense; GAAACCTTTGTTCAAGCGACATATG
>probe:Drosophila_2:1630059_at:247:325; Interrogation_Position=433; Antisense; GCGACATATGGATTTCGAATCGAGT
>probe:Drosophila_2:1630059_at:429:297; Interrogation_Position=448; Antisense; CGAATCGAGTTCATTGGCTGGCCTA
>probe:Drosophila_2:1630059_at:496:3; Interrogation_Position=460; Antisense; ATTGGCTGGCCTACTTCTGCGAAAT
>probe:Drosophila_2:1630059_at:43:581; Interrogation_Position=466; Antisense; TGGCCTACTTCTGCGAAATCACAGA
>probe:Drosophila_2:1630059_at:162:541; Interrogation_Position=623; Antisense; GGATCTTTACAATAGTTGGCGGCCA
>probe:Drosophila_2:1630059_at:17:675; Interrogation_Position=635; Antisense; TAGTTGGCGGCCAGCTTTTTACCCT
>probe:Drosophila_2:1630059_at:155:579; Interrogation_Position=643; Antisense; GGCCAGCTTTTTACCCTGAGTATAG
>probe:Drosophila_2:1630059_at:627:671; Interrogation_Position=654; Antisense; TACCCTGAGTATAGTTCCCAAAAAG

Paste this into a BLAST search page for me
GACAATTGCAATGTTTCTTAGCATTTCTTAGCATTATTATCGGAAACTCGATTATCGGAAACTCGTGCAAAAAGTGTGCAAAAAGTATACACCTGCGTGTACCTGCGTGTGGGATCGAAACCTTTGAAACCTTTGTTCAAGCGACATATGGCGACATATGGATTTCGAATCGAGTCGAATCGAGTTCATTGGCTGGCCTAATTGGCTGGCCTACTTCTGCGAAATTGGCCTACTTCTGCGAAATCACAGAGGATCTTTACAATAGTTGGCGGCCATAGTTGGCGGCCAGCTTTTTACCCTGGCCAGCTTTTTACCCTGAGTATAGTACCCTGAGTATAGTTCCCAAAAAG

Full Affymetrix probeset data:

Annotations for 1630059_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720