FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630061_at:

>probe:Drosophila_2:1630061_at:454:547; Interrogation_Position=230; Antisense; GGATGAGCCACTTGCAATTCAGCTT
>probe:Drosophila_2:1630061_at:215:167; Interrogation_Position=276; Antisense; AAATGCGGTACGATGCAGTGCGGCC
>probe:Drosophila_2:1630061_at:629:219; Interrogation_Position=334; Antisense; AAGTGCTTTTCAAACGACTCTTTCA
>probe:Drosophila_2:1630061_at:113:405; Interrogation_Position=349; Antisense; GACTCTTTCAAACCGCTGCAAATTA
>probe:Drosophila_2:1630061_at:408:283; Interrogation_Position=364; Antisense; CTGCAAATTATCTTCACCGGCGGAA
>probe:Drosophila_2:1630061_at:459:121; Interrogation_Position=417; Antisense; AGCGGATTTCTGTCCTGAGCTTAGC
>probe:Drosophila_2:1630061_at:346:609; Interrogation_Position=432; Antisense; TGAGCTTAGCATTCTTCACTTGAAG
>probe:Drosophila_2:1630061_at:720:437; Interrogation_Position=456; Antisense; GAGGCCGTCTGAAATCAATCCAATT
>probe:Drosophila_2:1630061_at:612:717; Interrogation_Position=479; Antisense; TTGCCCTATGCCAATATGACGTACC
>probe:Drosophila_2:1630061_at:83:57; Interrogation_Position=523; Antisense; ATGATGATGGCCACTTCGGATCTCA
>probe:Drosophila_2:1630061_at:647:543; Interrogation_Position=540; Antisense; GGATCTCAGATATTACGGCCGTCGA
>probe:Drosophila_2:1630061_at:90:241; Interrogation_Position=573; Antisense; AATAATCTCAAATCGTGCCTGCAAG
>probe:Drosophila_2:1630061_at:1:507; Interrogation_Position=587; Antisense; GTGCCTGCAAGACAACATTCCTGGA
>probe:Drosophila_2:1630061_at:201:31; Interrogation_Position=628; Antisense; ATAACTCCCAGTATGCTGTGTGCAA

Paste this into a BLAST search page for me
GGATGAGCCACTTGCAATTCAGCTTAAATGCGGTACGATGCAGTGCGGCCAAGTGCTTTTCAAACGACTCTTTCAGACTCTTTCAAACCGCTGCAAATTACTGCAAATTATCTTCACCGGCGGAAAGCGGATTTCTGTCCTGAGCTTAGCTGAGCTTAGCATTCTTCACTTGAAGGAGGCCGTCTGAAATCAATCCAATTTTGCCCTATGCCAATATGACGTACCATGATGATGGCCACTTCGGATCTCAGGATCTCAGATATTACGGCCGTCGAAATAATCTCAAATCGTGCCTGCAAGGTGCCTGCAAGACAACATTCCTGGAATAACTCCCAGTATGCTGTGTGCAA

Full Affymetrix probeset data:

Annotations for 1630061_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720